| Journal of General Virology |
| SUMMARY | INTRO | METHODS | RESULTS | DISCUSSION | FOOTNOTES | REFS |
| First posted online 13 September 2001 | FULL-LENGTH ARTICLE |
| Rec 4 June 2001; Acc 30 August 2001 | DOI: 10.1099/vir.0.17904-0 |
Monica K. Borucki, Brian J. Kempf, Carol D. Blair and Barry J. Beaty
Arthropod-borne and Infectious Diseases
Laboratory, Department of Microbiology, Colorado State University, Fort
Collins, CO 80523-1682, USA
The genetic consequences of passing three different strains of La Crosse (LAC) virus orally and transovarially in Aedes triseriatus mosquitoes were examined. Two of the LAC strains (WT LAC and LAC ORI) had been passaged numerous times in cell culture; the third strain (SM1-78) had been passaged only once in suckling mice. Genetic changes were monitored in three regions of the LAC genome after oral infection and dissemination in the mosquito, and transovarial transmission (TOT) of the virus to progeny. Sequence analyses were used to characterize the genetic changes occurring in regions of G1, G2 and N open reading frames (ORFs) during passage. Only one mutation was detected in the G1 ORF of SM1-78 virus after mosquito passage; however, numerous nucleotide and amino acid substitutions were detected in the G1 ORF of WT LAC and LAC ORI (cell culture-adapted viruses). In contrast to G1, the N and G2 ORF sequences examined were stable. Mutations introduced into viral genomes during replication in parental mosquitoes were expressed in progeny mosquitoes following TOT. Genetic diversity of virus populations from a single mosquito was examined by single-strand conformation polymorphisms analysis of the variable region of glycoprotein G1. LAC virus RNA genotype diversity was greatest in virus that infected and replicated in the midgut, and declined as virus disseminated from the midgut and infected ovaries and salivary glands.
Introduction |
Arthropod-borne viruses are maintained in nature
principally through biological transmission between susceptible vertebrate
hosts and haematophagous arthropod vectors (Beaty et al., 1997
). Therefore, these viruses must be able to
infect and replicate in cells of both vertebrates and invertebrates. The
ability of arboviruses to bridge the gap between vertebrate and
invertebrate hosts is likely to be a function of their RNA genomes. RNA
viruses have extremely high mutation rates (because of the poor fidelity
of RNA-dependent RNA polymerases and lack of proofreading enzymes) and are
proposed to exist as quasispecies populations (Holland et al.,
1982
). The quasispecies represents
a balance between the expansive influence of mutation and the
conservative forces of selection and is envisaged to contain a cloud of
genotypes that provide the genetic variability that enables RNA viruses
rapidly to exploit new niches (Holland et al., 1982
; Eigen & Biebricher, 1988
). The quasispecies is an excellent model to
explain the remarkable ability of arboviruses to pass rapidly and
continuously between vectors and vertebrate hosts. Certainly, passage of
arboviruses in laboratory systems rapidly selects for specific virus
subpopulations that are more fit in the respective system (de la Torre
et al., 1988
; Barrett et al.,
1990
; Novella et al., 1995
).
La Crosse (LAC) virus, a member of the family
Bunyaviridae, genus Bunyavirus, is the causative agent of La
Crosse encephalitis, the most commonly reported form of paediatric
arboviral encephalitis in the United States (Rust et al., 1999
; McJunkin et al., 2001
). LAC virus is transmitted horizontally and
vertically by Aedes triseriatus mosquitoes, with infected female
mosquitoes transmitting the virus transovarially to their progeny. LAC
virus overwinters in the infected eggs, and infected progeny emerge in the
spring to resume the transmission cycle (Grimstad, 1988
; Beaty & Calisher, 1991
; Beaty et al., 2000
).
LAC virus replication in its vector and vertebrate
hosts has been the subject of extensive investigation, and thus presents a
unique opportunity to determine if the quasispecies model enables
effective LAC virus passage between the two disparate systems. The genomic
coding strategies of LAC virus are known: the large (L) RNA segment (6980
nt) encodes the polymerase, the middle-sized (M) RNA segment (4526 nt)
encodes the envelope glycoproteins (G1 and G2) and nonstructural protein
NSM, and the small (S) RNA segment (984 nt) encodes the
nucleocapsid (N) protein and nonstructural protein NSs in overlapping
reading frames (Schmaljohn, 1996
; Gonzalez-Scarano & Nathanson, 1996
; Elliott et al., 1991
). Gene structurefunction studies revealed
that many important biological functions co-segregate with the M RNA
segment. In vertebrates, G1 is a major determinant of tissue tropisms,
membrane fusion, neuroinvasiveness and elicitation of neutralizing
antibody (Gonzalez-Scarano, 1985
; Gonzalez-Scarano et al., 1992
). In the vector, midgut infection and transmission also
co-segregate with the M RNA segment (Beaty et al., 1981
, 1982
). Importantly, it seems that G1 must be proteolytically
cleaved in the lumen of the midgut for efficient vector infection to
occur. This cleavage exposes either a receptor ligand or a hydrophobic
region on G2 that conditions vector infection (Ludwig et
al., 1989
). Proteolytic processing of G1 is
apparently not necessary for virus disseminating from the midgut to infect
secondary target organs (Ludwig et al., 1991
). G1 and G2 would thus seem to be good candidates
to monitor for selection during passage. The S RNA segment and its gene
products do not co-segregate with vector infection, and thus would
presumably not be subject to selection during mosquito passage. Little is
known about the potential variability in the sequence or differential
function of the L protein in invertebrate compared to vertebrate
hosts.
In these studies, three different strains of LAC virus with dramatically different laboratory passage histories were characterized genetically after Ae. triseriatus midgut infection, dissemination to salivary glands and ovaries, and transovarial transmission (TOT). At each stage of vector infection, portions of the G1, G2 and N open reading frames (ORFs) were sequenced to determine if selection occurred during virus passage in the vector. L segment sequences were not compared due to lack of knowledge about potential variability between hosts. Virus populations at each stage were also characterized for genetic diversity using single-strand conformation polymorphism (SSCP) analysis. The central hypothesis was that quasispecies populations of LAC viruses would respond genetically to the selective pressures posed by infection and replication in different mosquito tissues and organs. Further it was hypothesized that the most dramatic changes would occur in ORFs encoding the G1 and G2 proteins, which condition vector tropisms.
Methods |
Viruses. Three strains of LAC virus were
used, two of which had undergone moderate to extensive passage exclusively
in vertebrate cells, and one with minimal vertebrate passage. Prototype
LAC virus (WT LAC) originally came from the Yale Arbovirus Research Unit,
New Haven, CT, USA. The virus had been passaged three times in suckling
mice and six times in BHK-21 cells. LAC ORI was derived from WT LAC virus.
It was plaque-purified and used to generate reassortant viruses for gene
structurebiological function studies in vertebrates
(Gonzalez-Scarano et al., 1992
). The virus was kindly provided by Dr Neal Nathanson (U.
Pennsylvania) in 1985. It had been passaged many times in BHK-21 cells
after plaque purification. LAC ORI is phenotypically distinguishable from
WT LAC virus due to its low infection rate in Ae. triseriatus
mosquitoes (unpublished data; see Table 2). The
SM1-78 strain of LAC virus was isolated directly from the brain of a
patient who died of LAC encephalitis in 1978 via intracranial inoculation
into suckling mice of homogenized tissue from the brain cortex (Chandler
et al., 1998
). Virus isolated in the
first suckling mouse passage (SM1-78) was used in this study; the virus
was not passaged in cell culture.
Mosquito feeding and assay. The Ae.
triseriatus mosquitoes used in this study originated from field
material collected near La Crosse, Wisconsin, in 1981, and have been
colonized continuously at Colorado State University (Wasieloski et
al., 1994
). Three groups of 50100
female Ae. triseriatus mosquitoes were orally infected with an
artificial blood meal containing either WT LAC, LAC ORI or SM1-78. Medium
from BHK-21 cells infected with LAC virus (m.o.i. of 0.01 or 0.001) was
removed 2448 h after infection, clarified and used in blood meal
preparation. The blood meal consisted of equal volumes of infected cell
culture medium, washed fresh sheep red blood cells and foetal bovine serum
containing 10 % sucrose. The blood meal was prepared immediately before
feeding and warmed to 37 °C. Mosquitoes were fed by placing drops of
the blood meal onto the netting of their cartons for 1 h. Virus titre of
the blood meal at the end of feeding was determined by end-point assay in
Vero cells.
Mosquitoes that fed to repletion were maintained for
2 weeks extrinsic incubation, then assayed for LAC virus infection by
fluorescent antibody assay of leg tissue using a FITC-conjugated anti-LAC
polyclonal mouse antibody (Beaty et al., 1981
). Slides were examined at 200x using an Olympus BH2
epifluorescence microscope.
RNA isolation and preparation. The midguts, ovaries and salivary glands were dissected from live, anaesthetized, infected mosquitoes. Each organ was placed immediately in 200 µl of RNAgents (Promega) denaturation solution (guanidine thiocyanate and 2-mercaptoethanol). The organs were stored at 70 °C until processed. RNA was extracted with acid phenolchloroformisoamyl alcohol and finally dissolved in 17 µl RNase-free water.
LAC virus RNA sequence analysis. Portions of the LAC M and S RNA segments were amplified using the Access RTPCR kit (Promega). Four µl of total cellular RNA solution was added to 46 µl of reaction mixture containing 1x AMV/Tfl reaction buffer, 0.2 mM dNTP mix, 1 µM forward and reverse primers, 1 mM MgSO4, 5 units AMV reverse transcriptase and 5 units Tfl DNA polymerase. Reactions were incubated at 48 °C for 45 min for reverse transcription. After 2 min at 94 °C for RT inactivation and template denaturation, the samples were thermocycled as follows: 94 °C for 30 s, 55 °C for 1 min, 68 °C for 2 min for 3540 cycles, final extension at 68 °C for 7 min. Primers were designed using OLIGO 4.0 (National Biosciences) for amplification of a conserved region of the nucleocapsid ORF, a variable region of the G1 ORF and a variable region of the G2 ORF. The sequences and positions of the primers are listed in Table 1.
Table 1. RTPCR primers used to amplify regions of the LAC virus M and S segments
Three pairs of primers were designed to amplify portions of the N, G1 and G2 ORFs from LAC virus RNA for direct sequence analysis. The fourth primer pair was designed to amplify a smaller region at the 3´ end of the G1 amplicon for SSCP and sequence analysis.
|
Genome segment (ORF) |
Primer pair |
Primer sequence (5´ to 3´) |
Primer position |
Product size (bp) |
|
S (N) |
LSF |
GTCGGATTTGGTGTTTTATGA |
84104 |
266 |
|
LSR |
GACCCATCTGGCTAAATACC |
371390 |
||
|
M (G1) |
LMF2 |
CCAAAAGCAACAAAAGAAAGA |
15641584 |
410 |
|
LMR2 |
CTGAAGGCATGATGCAAAG |
19952013 |
||
|
M (G2) |
G2F |
GCCAGGTATGTAAGAAATGC |
215234 |
599 |
|
G2R |
ACACTCTGTGAATGGGTGAT |
834853 |
||
|
M (G1) |
LMF2I |
CTATATCCAAATCAGCACT |
18501868 |
126 |
|
LMR2 |
CTGAAGGCATGATGCAAAG |
19952013 |
RTPCR products were purified using a Wizard
PCR Prep kit (Promega) and sequenced directly by Macromolecular Resources
(Colorado State University) using an ABI Prism automated sequencing
apparatus. The primers used for RTPCR amplification were also used
as sequencing primers. Nucleotide sequences were aligned using SEQMAN II
(DNASTAR) and CLUSTAL W version 1.6 (Thompson et al., 1994
).
LAC virus RNA SSCP analysis. A 126 nt region
of the G1 ORF of WT LAC virus was amplified by RTPCR from midgut,
ovaries and salivary glands of a single infected mosquito as described
above using primers LMF2I and LMR2 (Table 1).
PCR products were cloned into pCR2.1 using a TA cloning kit (Invitrogen).
Individual clones were then amplified by PCR and analysed for SSCP (Farfan
et al., 1997
). Nucleotide sequences
of selected clones were determined as described above.
Results |
Oral infection rates
The oral and filial infection rates (FIR) for the three virus strains are presented in Table 2. Oral infection rates ranged from approximately 50 % for WT LAC and SM1-78 to 28 % for LAC ORI. Infected mosquitoes were then provided with an uninfected blood meal to stimulate a second gonadotropic cycle and FIRs were determined for these progeny. The mean FIRs ranged from 68 % for SM1-78 to only 1 % for LAC ORI (Table 2).
Table 2. Aedes triseriatus oral and filial infection rates (FIRs) with three strains of LAC virus
|
Virus |
Blood meal titre* |
Oral infection rate |
FIR |
FIR range (%)§ |
|
WT LAC |
7.5 |
51.2 (21/41) |
38.8 (19/49) |
1475 |
|
LAC ORI |
7.2 |
28.3 (19/67) |
1.2 (1/77) |
03 |
|
SM1-78 |
5.8 |
51.6 (47/91) |
68 (34/50) |
092 |
* Log10 TCID50 determined by end-point assay in Vero cells.
Per cent adult female mosquitoes orally infected as determined by immunofluorescent assay of leg tissue (no. infected/no. fed).
Per cent of total progeny mosquitoes transovarially infected as determined by immunofluorescent assay of head tissue (no. infected/total progeny)
§ Range of FIRs among the progeny of three, two and four female mosquitoes assayed after infection with WT LAC, LAC ORI and SM1-78, respectively.
Sequence comparison of LAC RNA from three virus strains after mosquito passage
For each of the three LAC virus strains, the genomic RNA sequences of virus used to prepare the blood meal (designated parental); viral RNA amplified from the midgut, ovaries and salivary glands of two to four orally infected mosquitoes; and viral RNA amplified from one to six transovarially infected progeny mosquitoes (designated virus strain adult number-progeny number, e.g. WT 9-5) were determined. A 266 nt region of the S segment nucleocapsid ORF, a 410 nt region of the M segment G1 ORF, and a 599 nt region of the M segment G2 ORF of each sample were sequenced. All sequences were compared to those of the parental WT LAC RNA. Overall, the N and G2 ORFs were found to be less variable than the G1 ORF.
WT LAC virus RNA sequences
No nucleotide changes from the parental WT LAC nucleocapsid ORF sequence were detected in any organs of the two orally infected and one transovarially infected mosquitoes examined.
G2 ORF RNA from one or more organs of all three WT LAC orally infected mosquitoes had a synonymous mutation at nucleotide 743. This substitution was not present in the virus transmitted to the single progeny mosquito tested. A synonymous change also was detected at position 559 in the RNA from all three organs of one of the orally infected mosquitoes (WT 14).
WT LAC G1 ORF RNA was analysed from the organs of three orally infected mosquitoes and six transovarially infected progeny. Mutations had occurred in RNA from one or more organs of two of the WT LAC-infected mosquitoes at positions 1912 and 1922, resulting in amino acid changes of Arg618 to Trp and Ala621 to Val. The third WT LAC-infected mosquito had the same mutation at position 1912 and an A to G transition at position 1928, resulting in an amino acid change of Glu623 to Gly. One or two of the same mutations were detected in viral RNA extracted from all of the WT LAC-infected progeny tested, with two progeny showing additional synonymous mutations at nucleotides 1749 and 1974 (Table 3).
Table 3. Amino acid and nucleotide substitutions in the G1 ORF of WT LAC, LAC ORI and SM1-78
Six positions in a 410 nt region of the G1 ORF of WT LAC (WT) and LAC ORI (ORI) consistently acquired either synonymous (shown as nucleotide bases) or nonsynonymous (shown as amino acids) mutations as compared to parental (Par) sequence when virus infected the midgut (MG) and disseminated to the ovaries (OV) and salivary glands (SG). Six WT LAC-infected progeny (WT 9-5, 9-6, 9-9; WT 14-1, 14-2, 14-3) and one LAC ORI-infected progeny (ORI 82-1) were analysed also for mutations in transovarially transmitted virus. SM1-78 RNA acquired only a single mutation in one midgut sample after replication in mosquitoes (not shown).
|
Sample |
Nucleotide at position |
|||||
|
1749 |
1912 |
1922 |
1928 |
1971 |
1974 |
|
|
Amino acid at position (where changed) |
||||||
|
618 |
621 |
623 |
||||
|
WT Par |
T |
Arg |
Ala |
Glu |
G |
T |
|
WT 5 MG |
T |
Trp |
Ala + Val* |
Glu |
G |
T |
|
WT 5 OV |
T |
Trp |
Val |
Glu |
G |
T |
|
WT 5 SG |
T |
Trp |
Val |
Glu |
G |
T |
|
WT 9 MG |
T |
Trp |
Ala |
Glu |
G |
T |
|
WT 9 OV |
T |
Trp |
Val |
Glu |
G |
T |
|
WT 9 SG |
T |
Trp |
Val |
Glu |
G |
T |
|
WT 9-5 |
C |
Trp |
Ala |
Glu |
G |
C |
|
WT 9-6 |
C |
Trp |
Ala |
Glu |
G |
C |
|
WT 9-9 |
T |
Arg |
Val |
Glu |
G |
T |
|
WT 14 MG |
T |
Trp |
Ala |
Gly |
G |
T |
|
WT 14 OV |
T |
Trp |
Ala |
Gly |
G |
T |
|
WT 14 SG |
T |
Trp |
Ala |
Gly |
G |
T |
|
WT 14-1 |
T |
Trp |
Ala |
Gly |
G |
T |
|
WT 14-2 |
T |
Trp |
Ala |
Gly |
G |
T |
|
WT 14-3 |
T |
Trp |
Ala |
Gly |
G |
T |
|
ORI Par |
C |
Trp |
Ala |
Glu |
A |
C |
|
ORI 1 MG |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 1 OV |
T |
Arg |
Val |
Glu |
G |
T |
|
ORI 1 SG |
T |
Arg |
Val |
Glu |
G |
T |
|
ORI 4 MG |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 4 OV |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 4 SG |
T |
Arg |
Ala + Val* |
Glu |
G |
T |
|
ORI 82 MG |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 82 OV |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 82 SG |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 82-1 |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 84 MG |
C |
Trp |
Ala |
Glu |
G |
C |
|
ORI 84 OV |
T |
Arg |
Ala |
Glu |
G |
T |
|
ORI 84 SG |
T |
Arg |
Ala |
Glu |
G |
T |
|
SM1-78 Par |
C |
Trp |
Ala |
Glu |
G |
C |
* Positions where overlapping electropherogram peaks indicated that there was a mixture of two virus sequences present in the same organ, one encoding Ala and the other Val at amino acid 621.
LAC ORI virus RNA sequences
The N ORF sequence analysed was identical in WT LAC and LAC ORI parental virus RNA. No nucleotide changes from the parental N ORF RNA sequence were detected in any sequences examined from two mosquitoes infected orally and one mosquito infected transovarially with LAC ORI virus.
The sequence of the G2 ORF region analysed also was identical for WT LAC and LAC ORI parental virus RNA. No nucleotide changes were detected in the G2 ORF of LAC ORI RNA from two of the three orally infected mosquitoes. A mutation occurred at nucleotide 609 in M RNA from the ovaries and salivary glands of the third mosquito. This substitution resulted in an amino acid change from Phe183 to Ser.
In contrast to the other two genome regions, in the G1 ORF region analysed, the LAC ORI parental virus RNA had mutations at nucleotide positions 1749, 1912, 1971 and 1974 as compared to WT LAC (Table 3). The mutation at nucleotide 1912 resulted in an amino acid change from Arg618 to Trp. LAC ORI G1 ORF RNA was analysed from the organs of four orally infected mosquitoes and one transovarially infected progeny. Upon replication and dissemination in the mosquito vector, LAC ORI acquired G1 mutations in RNA from most or all organs at positions 1749, 1912, 1922, 1971 and 1974 (Table 3). The mutation at position 1912 resulted in a Trp618 to Arg substitution, and that at 1922 in an Ala621 to Val substitution. Interestingly, the mutations at positions 1749, 1912, 1971 and 1974 resulted in restoration of the sequence of the parental WT LAC virus. Although 77 progeny mosquitoes from LAC ORI-infected females were tested by fluorescent antibody and RTPCR, only one was found to be infected. The LAC ORI virus in this mosquito retained the same mutations that were detected in the parental female (Table 3).
SM1-78 virus RNA sequences
The parental SM1-78 N ORF sequence had a C to T transition at position 179 by comparison to WT LAC RNA, resulting in a predicted amino change of Ser33 to Leu. No nucleotide changes from the parental RNA sequence were detected in the two orally infected and one transovarially infected mosquitoes examined.
By comparison to WT LAC parental RNA, SM1-78 G2 ORF RNA had a single nucleotide transition of C to T at position 786, resulting in an amino acid change of Thr242 to Ile. No nucleotide changes from the parental RNA sequence were detected in this region of the G2 ORF from any of the SM1-78 orally infected mosquitoes or in the RNA of the single SM1-78-infected progeny mosquito tested.
In the G1 ORF region analysed, SM1-78 parental RNA differed from WT LAC at nucleotide positions 1749, 1912 and 1974, resulting in the amino acid change Arg618 to Trp (Table 3). LAC ORI and SM1-78 parental RNA differed from each other only at nucleotide 1971 and had identical amino acid sequences in this region. In the organs of the three SM1-78-infected mosquitoes analysed, only a single mutation in one midgut was detected in the LAC G1 ORF. The substitution occurred at nucleotide 1915, resulting in an amino acid change from Asp619 to Asn. None of the six SM1-78-infected progeny tested contained viruses with mutations in this region of the G1 ORF (data not shown).
In one organ of two mosquitoes tested (WT 5 and ORI 4), there appeared to be equal amounts of viral RNA with two different nucleotides present at the same position (Table 3). This was detected by the presence of two overlapping electropherogram peaks, which were present in both strands of DNA, at the same position. SSCP analysis confirmed the presence of more than one genotype in a single organ.
SSCP analysis of quasispecies
To characterize genetic
diversity in a population of LAC viruses during replication and
dissemination in a single vector, a sequence of 126 nt within the G1 ORF
corresponding to the coding sequence for an antigenic determinant in the
G1 glycoprotein (Grady et al., 1983
, 1987
) was amplified from the
organs of a WT LAC orally infected mosquito by RTPCR and cloned.
Thirty clones each from the midgut, ovaries and salivary glands were then
amplified by PCR and analysed for SSCP (Fig. 1). To
compare diversity in the more homogeneous environment of cultured mosquito
cells, another 30 clones were prepared from WT LAC persistently infected
C6/36 cells and analysed. Each group of DNA samples with an identical
migration pattern was designated a genotype. The 30 midgut samples gave
rise to 13 different genotypes, the ovary samples gave rise to 11
genotypes, salivary gland samples to nine genotypes, and the C6/36 cell
culture samples to four genotypes. The predominant genotype for each organ
was designated the consensus genotype. When samples with the consensus
genotypes from each organ were analysed by SSCP together, they were shown
to have the same migration pattern (Fig. 1).
Fig. 1. SSCP gel of representative genotypes.
Thirty clones each from the midgut, ovaries and salivary glands of an
infected mosquito and from an infected C6/36 cell culture were analysed by
SSCP. In this gel, several representative genotypes were analysed together
with the consensus genotype from each sample group (C33, M33, O33, S33)
and cDNA from ovary samples used for sequence analysis. C, C6/36 cell
culture clones; M, midgut clones; O, ovary clones; S, salivary gland
clones.
Of the 120 samples that were analysed by SSCP, 68 (56.7 %) had the consensus genotype. The consensus genotype in the midgut comprised 10 samples (33.3 %) with the two next most predominant genotypes containing six (20 %) and two (6.7 %) samples respectively. The remaining 12 samples (40 %) had unique genotypes. The consensus genotype in the ovary comprised 20 samples (66.7 %), with the remaining 10 samples having unique genotypes (33.3 %). The consensus genotype in the salivary gland comprised 19 samples (63.3 %) with the two next most predominant genotypes each containing three samples (10 % each). The remaining five samples (16.7 %) had unique genotypes. In the C6/36 cells, 19 samples (63.3 %) had the consensus genotype. The two next most predominant genotypes contained seven (23.3 %) and three (10 %) samples respectively. The remaining sample (3.3 %) had a unique genotype.
Nucleotide sequences were determined for eight ovary samples, four of which had consensus and four had different genotypes, along with a consensus midgut sample, a consensus salivary gland sample and a consensus C6/36 sample. Sequences were aligned using the CLUSTAL W program and analysed for identity. All the consensus sequences had the same 126 bp sequence, which was identical to that determined for the G1 ORF from WT LAC parental RNA used for oral infection of mosquitoes (Table 3). The four ovary samples that had genotypes different from the consensus and from each other had from one to four nucleotide differences when compared to the consensus sequence and from four to eight nucleotide differences when compared to each other (Table 4).
Table 4. Nucleotide differences between sequenced samples
Data give number of nucleotide differences between the 126 bp G1 ORF sequences with the midgut, salivary gland and ovary consensus SSCP genotype and the four ovary samples that had an SSCP pattern different from the consensus when they were compared by CLUSTAL W alignment.
|
Midgut consensus |
Salivary gland consensus |
Ovary consensus |
Ovary 1 |
Ovary 28 |
Ovary 43 |
Ovary 45 |
|
|
Midgut consensus |
|
0 |
0 |
1 |
4 |
3 |
4 |
|
Salivary gland consensus |
|
0 |
1 |
4 |
3 |
4 |
|
|
Ovary consensus |
|
1 |
4 |
3 |
4 |
||
|
Ovary 1 |
|
5 |
4 |
5 |
|||
|
Ovary 28 |
|
7 |
8 |
||||
|
Ovary 43 |
|
6 |
|||||
|
Ovary 45 |
|
Of the total of 12 mutations in non-consensus ovary sequences examined, only four resulted in amino acid changes. In ovary 28, a T to C transition at position 1919 resulted in a Phe620 to Leu change and an A to G transition at nucleotide 1958 resulted in a Thr633 to Ala change. In ovary 43, an A to G transition at position 1935 resulted in a Lys625 to Arg change and an A to T transversion at nucleotide 1968 resulted in an Asp 636 to Gly change.
Discussion |
These studies tested the hypothesis that passage in vectors results in purifying selection for certain LAC virus genotypes in the quasispecies that are more fit for replication in the respective organ systems. Viruses with dramatically different laboratory passage histories (and thus different genotypes) were used to orally infect Ae. triseriatus and the resulting progeny viruses were compared to parental virus for genetic changes during vector passage. Specifically, genetic changes in the ORFs for three structural proteins of LAC virus were monitored during replication in mosquitoes and after TOT of the virus to mosquito progeny. Genetic and phenotypic changes are epidemiologically significant only if mutant viruses are transmitted to vertebrate hosts orally and/or to progeny transovarially. Therefore, virus populations were sampled from the midgut, ovaries, salivary glands and progeny of infected mosquitoes.
Surprisingly, the analysed regions of the glycoprotein G2 ORF as well as the nucleocapsid ORF were relatively stable; however, changes regularly occurred at six positions within a 225 nt sequence of the 410 nt amplicon from the G1 ORF of WT LAC and LAC ORI (Table 3). Seventy-five percent of these substitutions occurred initially in the midgut (18/24 substitutions) and 21 % (5/24) occurred initially in the ovaries and salivary glands. One synonymous substitution occurred only in two transovarially infected progeny. All of the substitutions detected in virus genomes from the midgut also were present in virus RNA from the salivary glands and ovaries of the same mosquito. Therefore, it appears that a majority of the genetic changes resulted from selection in the midgut, and these mutated viruses disseminated to the ovaries and the salivary glands. Of the mutations encoding amino acid substitutions that were detected in adult female mosquitoes, 77 % were present in the genomes of viruses transmitted to progeny.
All of the G1 ORF mutations resulting in amino acid
substitutions occurred in a 17 nt region of the 410 nt sequence analysed.
The most frequent amino acid substitution occurred at position 618 of the
G1 glycoprotein and involved either Arg replacing Trp (WT LAC) or Trp
replacing Arg (LAC ORI). SM1-78 RNA had a Trp codon at this position that
did not change upon mosquito passage. These data suggest that the presence
of Arg at position 618 may be a result of passage in cell culture (Table 3). It is possible that mutations consistently
occur at this position in response to changes in a region of the G1 ORF
outside the sequence analysed in order to preserve structural
properties of the protein, since amino acids 607 to 638 are
proposed to occur on the surface of the G1 protein and form an antigenic
determinant (Grady et al., 1983
, 1987
). Other mutations
resulting in amino acid substitutions occurred less frequently:
Asp619 to Asn in the midgut of a single SM1-78-infected
mosquito; Ala621 to Val in 29 % (6/21) of midguts, ovaries and
salivary glands of mosquitoes infected with either WT LAC or LAC ORI; and
Glu623 to Gly in a single WT LAC-infected mosquito, also
transmitted to progeny.
It has been proposed that in the mature virion, the
G1 glycoprotein masks G2, making it unavailable for binding to mosquito
midgut cells (Ludwig et al., 1989
), and that in the midgut G1 is cleaved by host proteases.
The exposed G2 glycoprotein then mediates binding of the virus to midgut
cells. However, following release of progeny virus into the haemocoel, G1
is no longer exposed to proteolytic conditions present in the midgut and
may mediate virus attachment to cells in the ovaries and salivary glands
(Ludwig et al., 1991
). Therefore, at least two modes of selection may act on
the G1 glycoprotein after virus infection of a mosquito. Viruses with G1
glycoproteins that are most readily cleaved by midgut proteases may be
most fit for infection of midgut cells upon ingestion in a blood meal.
When the virus progeny disseminate, selection for viruses with G1
glycoproteins that bind efficiently to the receptors on secondary target
organs may occur. The cellular receptor(s) for G1 has not been identified;
it is possible that G1 binds to a receptor present on both vertebrate and
invertebrate cells. In that case, viruses that have adapted to passage in
cell culture may not be at a disadvantage when infecting the secondary
organs of the mosquito vector. It is worth noting the correlation between
the lower oral infection rate for mosquitoes by LAC ORI (Table 2) and the observation that 66 % of the G1 ORF
mutations detected were in LAC ORI RNA vs 30.5 % of mutations in WT LAC
and 6.6 % in SM1-78.
Mutations resulting in a conservative change from Ala621 to Val in the G1 glycoprotein of WT LAC and LAC ORI and synonymous substitutions at nucleotide positions 1749, 1971 and 1974 in the M RNA of WT LAC and LAC ORI (Table 3) may reflect differences in codon usage between cultured vertebrate cells and mosquito cells.
The SSCP analysis of genetic diversity within the virus population in a single mosquito suggested that a greater variety of quasispecies were fit to replicate in mosquito organs than in cell culture. In persistently infected C6/36 cells only four genotypes were detected among 30 samples. The greatest variety of genotypes was detected in the mosquito midgut, and as the infection disseminated from the midgut to other organs, the number of genotypes was reduced. The consensus genotype was identical in midguts, salivary glands and ovaries as revealed by both SSCP and sequence analyses.
The results of this study demonstrate that strains of LAC virus that have been serially passaged in cell culture may undergo balancing selection when reintroduced into the mosquito host due to the presence of different selective constraints present in the two disparate amplification systems. Repeated passage of WT LAC and LAC ORI in cell culture may have selected for viruses that were less fit for replication in mosquitoes. When reintroduced into mosquitoes, these viruses underwent genetic changes necessary to readapt to efficient replication in the mosquito host. SM1-78 virus showed the least amount of change during oral and transovarial passage in mosquitoes. This may be attributable to the fact that SM1-78 virus had not been repeatedly passaged in vertebrate cells. Most of the genetic changes were detected in the G1 ORF, whereas the sequences of the G2 and N ORFs were relatively stable. If genetic changes are indeed a function of selection based on tissue tropisms, it is surprising that few changes occurred in the G2 sequence analysed. However, since it is postulated that glycoprotein G2 is involved only in mosquito midgut infection and not in binding to vertebrate cells, cell culture passage would not be expected to select for different genotypes.
It is important to note that virus mutations acquired during replication in parental mosquitoes were detected in their progeny. Thus, TOT can serve to amplify and to maintain new virus genotypes resulting from vector passage in nature.
This research was supported by grant AI 32543 from the National Institute of Allergy and Infectious Diseases. We thank Cindy Meredith for expert assistance in the insectary.
The GenBank accession numbers for the sequences of the WT LAC, LAC ORI and SM1-78 strains are as follows: nucleocapsid (AF417246AF417248), G1 (AF417249AF417251) and G2 (AF417252AF417254).
References |
© 2001 SGM
This article is now available in the December 2001 print issue of JGV (vol. 82, 29192926). The complete issue of the journal may be seen in electronic form on JGV Online.