JGV logo Journal of General Virology

SUMMARY INTRO METHODS RESULTS DISCUSSION FOOTNOTES REFS

First posted online 19 October 2000 FULL-LENGTH ARTICLE
Rec 13 July 2000; Acc 28 September 2000 DOI 10.1099/vir.0.17274-0

Transient expression of a GUS reporter gene from cauliflower mosaic virus replacement vectors in the presence and absence of helper virus

Rita Viaplana, David S. Turner and Simon N. Covey

John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, UK


Vectors based upon the genome of cauliflower mosaic virus (CaMV) have only a limited capacity for replicating foreign DNA in plants. A helper virus system has been developed to complement CaMV constructs capable of carrying a large foreign gene (glucuronidase; GUS). GUS replaced part or all of the non-essential CaMV gene II and the essential genes III, IV and V. This construct was co-inoculated mechanically with wild-type CaMV helper virus onto Brassica rapa leaves to promote GUS vector complementation. After 1 week, blue foci of GUS activity were observed in the centres of the local lesions. Leaves inoculated with the GUS construct in the absence of helper virus showed randomly distributed foci of GUS activity that were generally smaller than the lesion-associated GUS foci. Inoculation with a simple non-replicating CaMV 35S promoter–GUS construct also produced small GUS foci. Co-inoculation of helper virus with CaMV gene replacement vectors in which replication was prevented by moving the primer-binding site or by deletion of an essential splice acceptor produced only small, randomly distributed GUS activity foci, demonstrating that the lesion-associated foci were produced by gene expression from replicating constructs. These experiments show that CaMV genes III–V can be complemented by wild-type virus and replacement gene vectors can be used for transient gene expression studies with CaMV constructs that distinguish gene expression associated with a replicating vector from that associated with a non-replicating vector.



Introduction

Plant virus vectors have a wide range of potential applications for studying molecular processes in plant cells, with successes reported for both DNA and RNA viruses (Timmermans et al., 1994; Porta & Lomonossoff, 1996; Scholthof et al., 1996). The first plant virus vector was developed from the pararetrovirus cauliflower mosaic virus (CaMV) (see Gronenborn, 1987; Covey & Hull, 1992). CaMV has a circular dsDNA genome of 8 kbp that is infectious to plants as virion DNA and as cloned DNA. CaMV replacement vectors have exploited the non-essential gene II, encoding the viral aphid transmission factor, P2, to achieve systemic replication and expression of dihydrofolate reductase (Brisson et al., 1984), interferon (De Zoeten et al., 1989) and metallothionine (Lefebvre et al., 1987). Limitations to the use of CaMV vectors have included an upper size limit of ~500 bp of foreign DNA and the requirement for expression of the inserted gene to accommodate the linked translation of CaMV genes mediated by the viral P6 translational transactivator gene. A further limitation to the usefulness of systemic CaMV replacement vectors has been the instability and ejection of inserted foreign DNA owing to recombinational mechanisms, which probably increases with larger pieces of non-viral DNA (see Gronenborn, 1987; Covey & Hull, 1992). However, CaMV vectors can be used to study small inserts such as plant introns, which have been inserted into non-essential parts of gene II (Hohn et al., 1986), the 35S promoter (Turner et al., 1996; Noad et al., 1997) and other genome locations (Pennington & Melcher, 1993). Transient expression of non-replicating CaMV constructs has also been used widely, especially in the analysis of the complex translation strategy of CaMV and its relationship to the P6 protein (Fütterer & Hohn, 1991; De Tapia et al., 1993).

We have been exploring the potential to develop CaMV vectors capable of expressing relatively large reporter genes like that for glucuronidase (GUS). Vectors based upon interdependent complementation of bipartite defective CaMV replicons have not yet been developed, even though this type of complementation offers promise (Gronenborn, 1987; Hirochika & Hayashi, 1991). CaMV mutants defective in movement can also be complemented by wild-type virus during systemic infection (Thomas et al., 1993). We have determined whether this type of complementation can be exploited to express CaMV-based GUS gene vectors. Our experiments have shown that transient expression of the GUS gene from a replicating vector in the presence of helper virus is possible and that this can be distinguished from non-replicative expression of the reporter gene.

Methods

Virus and plants. CaMV isolate Cabb B-JI was used as helper virus and as the originator of vector constructs. All inoculations were performed on leaves of Brassica rapa rapifera L. cv. 'Just Right' turnip plants propagated in a containment glasshouse at 18–20 °C in a minimum photoperiod of 16 h.

Vector constructs. CaMV replacement vector pBjigus1 was derived from pCa24, a clone of the CaMV Cabb B-JI genome inserted into pAT153 at the unique SalI site. The GUS gene was obtained from plasmid pJJ3431, kindly provided by Jonathan D. G. Jones (Jones et al., 1992). A GUS fragment was isolated following digestion of pJJ3431 with XhoI and XbaI and this was ligated into pGEM11 (Promega) generating pGemgus. A linker (Table 1; oligos 1 and 2) with appropriate ends was inserted near the 5´ end of the GUS gene following digestion of pGemgus with XhoI and NcoI, producing clone pGemlgus. Similarly, a second linker (Table 1; oligos 3 and 4) was inserted into the 3´ end of the GUS gene in pGemlgus after digestion with XbaI and NsiI to make clone pGemlgusl. The GUS gene was then isolated as an XhoI–NsiI fragment and cloned into the appropriate fragment of pCa24 digested with XhoI and partially digested with NsiI. The GUS gene was thus inserted between nucleotides 1644 (XhoI) and 3556 (NsiI) of the CaMV Cabb B-JI genome.


Table 1. Oligonucleotides used in virus constructs

Oligonucleotide

Sequence (5´ to 3´)

1

TCGAGGAGCTCCTAAC

2

CATGGTTAGGAGCTCC

3

TCGAGT

4

CTAGAGCTCATGCA

5

TGGTTCATCTTGGAGCGGTCA

6

CGATCTCGAGCATCGGTTGACCCGTAATGCTCATAATT

7

CTAGCGGATCCGCGGATATCTTTTAAGAGTGGGGGGGTTGGATCCTAG

8

CTAGCTAGGATCCAACCCCCCCACTCTTAAAAGATATCCGCGGATCCG

9

ATGAATAGGCCTATGACCA

10

TGGTCATAGGCCTATTCAT

11

CTCTAACGAGATATCCACAGA

12

TCTGTGGATATCTCGTTAGAG

13

TAATCCGCATATGCCCCCGCTTA

14

TAAGCGGGGGCATATGCGGATTA

15

TATGGCTAGCCCATGAATAGG

16

CCTATTCATGGGCTAGCCA

17

TGGTATCAGAGCCATGCTGCAG

18

CTGCAGCATGGCTCTGATACCA



Vector pBjigus2, in which the GUS gene was inserted immediately after CaMV gene I, was constructed from pBjigus1 as follows. The bacterial vector pAT153 was first replaced by pGEM5, giving clone pBjigus1b. A fragment between nucleotides 744 and 1347 was amplified by PCR with primers (Table 1; oligos 5 and 6) that produced ends digestible with NsiI and XhoI. A second clone (pBIB5) comprised the SpeI–XhoI (110–1644) fragment of wild-type CaMV. The NsiI–XhoI PCR fragment was used to replace a similar fragment in pBIB5, providing a construct in which the 5´ portion of CaMV gene II had been deleted, giving clone pRV4. Plasmid pRV4 was digested with BstEII and XhoI and ligated to BstEII/XhoI-cut pBjigus1. Since this clone had lost one of the two plus-strand priming sequences, we re-inserted an active primer (+ps sequence) at the end of the GUS gene by cloning a linker (Table 1; oligos 7 and 8) into the BamHI site of pBjigus2, generating a +ps sequence that we have shown previously to be active (Noad et al., 1998).

Construct pPbs2 was produced from the CaMV Cabb B-JI genome by removal of the tRNA primer-binding site (pbs) at position 1, which was then relocated at the end of gene VII at position 333. The starting clone was pG1sbji, the Cabb B-JI genome inserted into pGEM1 at the SalI site. From this, an MluI–XhoI fragment was isolated and cloned into pGEM7, to give pG7M-X. Mutagenesis of an A in pG7M-X to a C residue using oligos 9 and 10 (Table 1), thus creating a StuI site at position 22, was achieved with the QuikChange mutagenesis system (Stratagene). Similarly, an A to C change at position 322 created an EcoRV site, using oligos 11 and 12 (Table 1). The resulting clone was digested with DraII and the large fragment re-ligated to give clone pG7m-xM2dra. Mutagenesis with oligos 13 and 14 (Table 1) created an NdeI site at 8011 to give pG7m-xM2draM1. This was digested with NdeI and StuI and a further linker (Table 1; oligos 15 and 16) was inserted following removal of the pbs. This clone was then digested with EcoRV and a new pbs was inserted (Table 1; oligos 17 and 18) to give pG7m-xM2draM3. Following digestion with MluI and XhoI, the fragment was inserted into pG1sbji to give pPbs2. The construct with the mutated pbs elements was combined with pBjigus1 by isolating an NsiI fragment containing the GUS gene and replacing the equivalent fragment in pPbs2 to produce pPbs2gus1.

Inoculations and detection of GUS activity. Appropriate cloned DNAs were prepared and mixed as necessary. Co-inoculations contained 1 µg of each DNA; single inoculations contained 1 µg DNA. Inoculations were in 10 µl TE (10 mM Tris–HCl, pH 7.6, 1 mM EDTA) with 0.03 g/ml Celite abrasive. The second true leaf of turnip seedlings was inoculated when the leaves were at least 2 cm long. GUS activity was detected after 7 days by using X-glucuronide exactly as described previously (Al-Kaff et al., 1998). Chlorophyll was removed by treatment of leaves with 100 % ethanol.

Results

Transient expression of GUS from a CaMV gene replacement vector

The CaMV genome (Fig. 1 a) has only a limited capacity for foreign DNA, with an upper limit probably of less than 1 kb, depending upon the amount of non-essential DNA deleted. Therefore, to construct a replicating CaMV vector capable of carrying a large gene (~2 kb) such as GUS, it is necessary to adopt a complementation strategy. In construct pBjigus1 (Fig. 1 b), the GUS gene was inserted between the unique XhoI site (1644) in gene II and an NsiI site (3782) within the 5´ end of gene V. This insertion presumably inactivated genes II–V by partial or complete gene replacement. The construct pBjigus1 was 7804 bp in size, which is larger than the infectious CaMV gene II deletion mutant CM4-184 (7603), and contained all of the known cis-acting elements required for CaMV gene expression and replication. At the 5´ insertion site, a linker caused premature termination of the truncated gene II; the GUS gene overlapped the end of gene II by 13 bp (Fig. 2).


Fig. 1Fig. 1. CaMV genome and vector constructs. (a) The circular dsDNA genome of CaMV showing the location of seven genes (I–VII), the 35S and 19S promoters and the primers for reverse transcription including the primer-binding site (pbs) for initiation of DNA minus-strand synthesis and the two DNA plus-strand primers (+ps1, +ps2). (b) Structure of CaMV constructs represented as the terminally redundant 35S RNA genome relative to the wild-type 35S RNA. In construct pPbs2, the pbs has been moved to the end of gene VII. In pBjigus1, the GUS gene replacement was inserted in a position equivalent to gene III. In pPbs2gus1, the pbs of pBjigus1 was moved to the end of gene VII. In pBjigus2, the GUS gene replacement was inserted in a position equivalent to gene II. In 35Sgus, the GUS gene is regulated by the 35S promoter and Agrobacterium Ti plasmid octopine synthase transcription terminator (OCSt).



Plasmid DNAs of pCa24GS, a clone of CaMV isolate Cabb B-JI, and pBjigus1 were digested with the appropriate restriction enzyme to release the bacterial cloning vectors before inoculation. The two DNAs were mixed in equimolar proportions and 2 µg samples were inoculated mechanically onto the first or second true leaves of turnip seedlings. After 1 week, inoculated leaves had developed local lesions (usually at least four) typical of CaMV infections following inoculation with cloned DNA (Table 2). Leaves were excised and assayed for GUS activity. We observed discrete regions of GUS activity that coincided with the precise centres of several, but not all, local lesions of the co-inoculated plants (Fig. 3 a, c). In different experiments, usually at least half of the local lesions contained GUS-staining centres (Table 2; Fig. 3 c). The zones of GUS activity differed in size, but were never larger than about half the lesion diameter (Fig. 3 a, c). In green leaves, large spots of GUS activity were usually observed only within local lesions and were not detected in systemically infected leaves of co-inoculated plants at 2–3 weeks post-inoculation. When chlorophyll was removed from leaves by clarification with ethanol, additional smaller spots of GUS activity were usually observed (Fig. 3 b) and the local lesions could sometimes still be discerned, since they were relatively free of brown polyphenol pigment (Fig. 3 d). Some of the additional small blue spots were apparently not associated with obvious local lesions.


Table 2. Transient GUS activity from CaMV constructs

   

Blue spots (n)

Inoculation

Local lesions (n)

In local lesions

Not in local lesions

Wild-type (wt)*

6, 8, 8

0

0

wt+pBjigus1*

6, 7, 6

3, 4, 3

8, 10, 13

wt+pBjigus2

4–8

0

>9

wt+pPbs2gus1

4–8

0

>8

pBjigus1

0

0

>5

pBjigus2

0

0

>5

pPbs2gus1

0

0

>5

35Sgus

0

0

>9

* Data shown are per leaf from three individual leaves in a typical experiment. For the remaining samples, 3–5 leaves were examined and the minimum number of blue spots per leaf is shown; numbers of non-lesion-associated GUS spots often exceeded 15 per leaf.



Closer inspection of the large lesion-associated blue spots revealed a complex structure, with minor satellite spots of GUS activity around the central multicellular zone (Fig. 3 e, f). The sizes of blue spots and their location in lesions suggested that the GUS gene vector had undergone limited replication and spread to a few adjacent cells complemented by the wild-type helper virus. However, we could not discount the possibility that substrate product had leaked to adjacent cells from a single cell containing the reporter enzyme. In control inoculations with pBjigus1 DNA alone, we were surprised to see several small foci of GUS activity on each inoculated leaf, presumably limited to single cells (Fig. 3 g). In different experiments, the number of background blue spots varied but was usually more than five per leaf, and there were often up to twenty per leaf, but the total number was difficult to determine because of their small size in relation to that of the leaf.

GUS expression from replicating and non-replicating gene vectors

The above experiments suggested that a replication-defective CaMV construct containing a GUS gene could show expression following manual inoculation of leaves with vector DNA. The relatively small size of the background blue foci following inoculation of pBjigus1 DNA alone showed that measurable GUS activity was limited to one or a few cells, with little or no local movement of blue product to adjacent cells. As a positive control for localized GUS activity, we inoculated leaves with DNA of a simple 35S–GUS–octopine synthase terminator construct (Fig. 1). Blue spots were observed after 1 week and were generally similar in size and distribution to those seen following single pBjigus1 inoculations (Fig. 3 h). No difference in the pattern of GUS expression was observed when DNAs were inoculated as linearized or supercoiled forms (data not shown).


Fig. 2Fig. 2. Junction sequences of constructs. (a) Wild-type CaMV in gene II showing the DNA plus-strand primer (+ps2) upstream of the XhoI insertion site. (b) After insertion of the GUS gene in wild-type DNA, producing construct pBjigus1. (c) The gene I–GUS junction in pBjigus2. (d) Wild-type sequence in the region of the pbs and gene I. (e) After movement of the pbs in construct Pbs2.



We next wanted to show that the often larger zones of GUS activity located in the centres of local lesions following co-inoculation with wild-type virus had resulted from vector replication complemented by wild-type helper virus. The wild-type CaMV genome was modified by moving the pbs origin of reverse transcription from its normal location at the beginning of gene VII to the end of gene VII, generating construct pPbs2 (Fig. 1 b). Inoculation of plants with pPbs2 resulted in no symptoms, from which we concluded that it was not infectious. The same mutation was then introduced into pBjigus1 and the construct (pPbs2gus1) was co-inoculated with wild-type virus. In this case, no large or small blue spots were observed in local lesions centres, but background blue spots were found following chlorophyll removal (Table 2). This shows that the lesion-associated blue spots result from expression of replicated pBjigus1 following complementation by wild-type helper virus. We have found that local lesion-associated foci of GUS activity varied in size between large and small, with the latter being indistinguishable in size from the background non-lesion-associated blue spots. Thus, the size of blue foci was not used as a primary measure of replicative competence of a construct but rather its frequency of association with lesion centres.

Evidence that a CaMV splice acceptor produces a molecule with a cis-acting function

We were intrigued by the non-replicative expression of pBjigus1, since the GUS gene was internal in an equivalent position to CaMV gene III. Expression of the CaMV genome is complex and involves linked translation of internal genes mediated by the gene VI protein P6, a translational transactivator (Fütterer & Hohn, 1991; De Tapia et al., 1993; Hohn & Fütterer, 1997). Splicing is also an essential part of the CaMV replication cycle (Kiss-László et al., 1995), although its specific involvement in expression of particular CaMV genes is not understood. A spliced RNA molecule has been detected in plants in which a splice donor in the 35S RNA leader (Kiss-László et al., 1995) was fused to an acceptor site at 1508, located within gene II. Since mutagenesis of the 1508 splice acceptor abolishes CaMV infectivity, it has been suggested that the leader-to-1508 spliced molecule is a possible subgenomic mRNA for the essential CaMV gene III. To apply our transient expression system to this problem, we made a construct in which the GUS gene replaced the complete gene II–gene V sequence in such a way as to remove the splice acceptor at 1508, in construct pBjigus2 (Fig. 1 b). Since the gene III protein, P3, is produced by the wild-type helper virus to complement the missing protein in the vector, this should negate the requirement for the 1508 splice acceptor in pBjigus2. Leaves were co-inoculated with pBjigus2 and wild-type helper virus, with the expectation of observing lesion-associated GUS activity spots. However, in several experiments, we never observed lesion-associated GUS activity following co-inoculation with these constructs but found only background, non-lesion-associated, small blue spots (Fig. 3 i; Table 2), from which we conclude that GUS expression had occurred in the absence of vector replication.


Fig. 3Fig. 3. Expression of GUS gene activity 1 week after inoculation of turnip seedlings with various constructs. (a)–(f) Co-inoculation of wild-type helper virus with pBjigus1, before (a, c) and after (b, df) removal of chlorophyll. l, Local lesion; lb, lesion containing a central zone of GUS activity. (g)–(i) Small non-lesion-associated blue spots produced by single inoculations with pBjigus2 (g), 35S–GUS (h) and co-inoculation of wild-type and pBjigus2 (i) are labelled sb. Bars represent approx. 1 mm.



Discussion

We have developed a virus helper-dependent vector system that expresses the largest transgene so far reported from a CaMV replicon. The GUS reporter gene replacements encompassed CaMV genes II–V, demonstrating complementation of essential functions associated with CaMV structural proteins P3 and P4 and at least one component of the viral reverse transcriptase (P5). The helper-dependent vector was also capable, apparently, of limited cell-to-cell movement. These conclusions are based upon the observation that GUS expression was located in the centres of local lesions following co-inoculation with wild-type helper virus. Moreover, an area up to half the diameter of the local lesions, although often less extensive than this, contained the vector expressing the reporter gene. Further movement and expression of the vector was presumably restricted through competition by wild-type virus. We have attempted to extend expression of the vector by making helper-virus constructs disabled in P1 expression (Thomas et al., 1993), but co-inoculation rapidly led to generation of wild-type virus by recombination (our unpublished results). Unexpectedly, we found that inoculation of GUS vector constructs alone, which presumably lack the ability to replicate, showed reporter gene expression, most likely limited to single or a few cells that were not associated with local lesions. This has enabled us to distinguish replication-associated reporter activity from non-replicative expression. Co-inoculation of helper virus with a replication-defective vector in which the pbs origin of reverse transcription (Turner & Covey, 1984) had been moved showed limited non-lesion-associated GUS activity.


Fig. 4Fig. 4. Possible routes of CaMV gene expression. (a) In wild-type CaMV, it is hypothesized that gene II expression could be transactivated by the gene VI protein, with gene III expressed from a subgenomic mRNA produced from a splice between a donor (sd) in the 35S RNA leader and an acceptor (sa) in gene II. With this hypothetical scheme, the GUS gene in construct pBjigus1 (b) could be expressed after an RNA splice and, in pBjigus2 (c), by P6 transactivation.



The observations of expression of the GUS gene as an internal open reading frame of the CaMV vector, even in the absence of helper virus, suggests strongly that RNA processing or expression of other viral genes had occurred. Translation of internal open reading frames can occur through the activity of the CaMV P6 translational transactivator protein (Fütterer & Hohn, 1991). However, it is not clear which CaMV genes are expressed by this process during virus replication in vivo. This is complicated further by the discovery of multiple splice donor and acceptor sequences in the 5´ third of the genomic 35S RNA transcript. Moreover, a splice donor within the non-essential gene II at position 1508 is apparently essential for virus replication (Kiss-László et al., 1995). Thus, expression of CaMV gene II might be expected to occur by P6-mediated translational transactivation, with gene III expression resulting from a splice between a donor site in the 35S RNA leader sequence at position 7909 and the essential acceptor in gene II at 1508 (see Fig. 4). In construct pBjigus1, the GUS gene is located in a position equivalent to gene III, with its possible mode of expression through a spliced mRNA (Fig. 4 b). In construct pBjigus2, the GUS gene was inserted in the gene II position in such a way as to eliminate the splice acceptor at 1508 (Fig. 4 c). Transgene expression in this case could have occurred by P6 transactivation, although we cannot exclude the possibility that some other splice produced the necessary mRNA. The unexpected consequence of deleting the 1508 splice acceptor was that it rendered the vector incapable of replication, judged by the absence of lesion-associated GUS activity when co-inoculated with helper virus. The pBjigus2 construct lacked gene III or an equivalent gene, so the requirement for a splice to the missing acceptor should have been obviated. This suggests that the primary role of the 1508 splice acceptor is not for expression of gene III but that it is required for some other essential virus function required in replication. Alternatively, the region deleted in this construct might play a role in some other process, although it is difficult to speculate what this might be, especially since gene II is non-essential except for the splice acceptor. Our CaMV vector–helper system, which allows us to distinguish replication-associated gene expression from non-replicative gene expression, should provide a new approach to investigate this and other virus mechanisms.

We thank the John Innes Foundation for a PhD studentship to R. V. and the BBSRC for grant-aided support to the John Innes Centre. We also thank Professor J. W. Davies for helpful comments. This work was carried out under MAFF licence PHL 11B/3013(3/1999).


References

Al-Kaff, N. S., Covey, S. N., Kreike, M. M., Page, A. M., Pinder, R. & Dale, P. J. (1998). Transcriptional and posttranscriptional plant gene silencing in response to a pathogen. Science 279, 2113–2115.

Brisson, N., Paszkowski, J., Penswick, J. R., Gronenborn, B., Potrykus, I. & Hohn, T. (1984). Expression of a bacterial gene in plants. Nature 310, 511–514.

Covey, S. N. & Hull, R. (1992). Genetic engineering with double-stranded DNA viruses. In Genetic Engineering with Plant Viruses, pp. 217–249. Edited by J. W. Davies & T. M. A. Wilson. Boca Raton, FL: CRC Press.

De Tapia, M., Himmelbach, A. & Hohn, T. (1993). Molecular dissection of the cauliflower mosaic virus translation transactivator. EMBO Journal 12, 3305–3314.

De Zoeten, G. A., Penswick, J. R., Horisberger, M. A., Ahl, P., Schultze, M. & Hohn, T. (1989). The expression, localization, and effect of a human interferon in plants. Virology 172, 213–222.

Fütterer, J. & Hohn, T. (1991). Translation of a polycistronic mRNA in the presence of the cauliflower mosaic virus transactivator protein. EMBO Journal 10, 3887–3896.

Gronenborn, B. (1987). The molecular biology of cauliflower mosaic virus and its application as plant gene vector. In Plant DNA Infectious Agents, pp. 1–29. Edited by T. Hohn & J. Schell. Vienna: Springer-Verlag.

Hirochika, H. & Hayashi, K. (1991). A new strategy to improve a cauliflower mosaic virus vector. Gene 105, 239–241.

Hohn, T. & Fütterer, J. (1997). The proteins and functions of plant pararetroviruses: knowns and unknowns. Critical Reviews in Plant Sciences 16, 133–161.

Hohn, B., Balazs, E., Ruegg, D. & Hohn, T. (1986). Splicing of an intervening sequence from hybrid cauliflower mosaic viral RNA. EMBO Journal 5, 2759–2762.

Jones, J. D., Shlumukov, L., Carland, F., English, J., Scofield, S. R., Bishop, G. J. & Harrison, K. (1992). Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenic Research 1, 285–297.

Kiss-László, Z., Blanc, S. & Hohn, T. (1995). Splicing of cauliflower mosaic virus 35S RNA is essential for viral infectivity. EMBO Journal 14, 3552–3562.

Lefebvre, D. D., Miki, B. L. & Laliberte, J. F. (1987). Mammalian metallothionein functions in plants. Biotechnology 5, 1053–1056.

Noad, R. J., Turner, D. S. & Covey, S. N. (1997). Expression of functional elements inserted into the 35S promoter region of infectious cauliflower mosaic virus replicons. Nucleic Acids Research 25, 1123–1129.

Noad, R. J., Al-Kaff, N. S., Turner, D. S. & Covey, S. N. (1998). Analysis of polypurine tract-associated DNA plus-strand priming in vivo utilizing a plant pararetroviral vector carrying redundant ectopic priming elements. Journal of Biological Chemistry 273, 32568–32575.

Pennington, R. E. & Melcher, U. (1993). In planta deletion of DNA inserts from the large intergenic region of cauliflower mosaic virus DNA. Virology 192, 188–196.

Porta, C. & Lomonossoff, G. P. (1996). Use of viral replicons for the expression of genes in plants. Molecular Biotechnology 5, 209–221.

Scholthof, H. B., Scholthof, K.-B. G. & Jackson, A. O. (1996). Plant virus gene vectors for transient expression of foreign proteins in plants. Annual Review of Phytopathology 34, 299–323.

Thomas, C. L., Perbal, C. & Maule, A. J. (1993). A mutation of cauliflower mosaic virus gene I interferes with virus movement but not virus replication. Virology 192, 415–421.

Timmermans, M. C. P., Das, O. P. & Messing, J. (1994). Geminiviruses and their uses as extrachromosomal replicons. Annual Review of Plant Physiology and Plant Molecular Biology 45, 79–112.

Turner, D. S. & Covey, S. N. (1984). A putative primer for the replication of cauliflower mosaic virus by reverse transcription is virion-associated. FEBS Letters 165, 285–289.

Turner, D. S., McCallum, D. G. & Covey, S. N. (1996). Roles of the 35S promoter and multiple overlapping domains in the pathogenicity of the pararetrovirus cauliflower mosaic virus. Journal of Virology 70, 4514–4521.



UpJGV Direct table of contents

© 2000 SGM

This article is now available in the January 2001 print issue of JGV (vol. 82, 59–65). The complete issue of the journal may be seen in electronic form on JGV Online.