| Journal of General Virology |
| SUMMARY | INTRO | METHODS | RESULTS | DISCUSSION | FOOTNOTES | REFS |
| First posted online 19 October 2000 | FULL-LENGTH ARTICLE |
| Rec 13 July 2000; Acc 28 September 2000 | DOI 10.1099/vir.0.17274-0 |
Rita Viaplana, David S. Turner and Simon N. Covey
John Innes Centre, Norwich Research Park,
Colney, Norwich NR4 7UH, UK
Vectors based upon the genome of cauliflower mosaic virus (CaMV) have only a limited capacity for replicating foreign DNA in plants. A helper virus system has been developed to complement CaMV constructs capable of carrying a large foreign gene (glucuronidase; GUS). GUS replaced part or all of the non-essential CaMV gene II and the essential genes III, IV and V. This construct was co-inoculated mechanically with wild-type CaMV helper virus onto Brassica rapa leaves to promote GUS vector complementation. After 1 week, blue foci of GUS activity were observed in the centres of the local lesions. Leaves inoculated with the GUS construct in the absence of helper virus showed randomly distributed foci of GUS activity that were generally smaller than the lesion-associated GUS foci. Inoculation with a simple non-replicating CaMV 35S promoterGUS construct also produced small GUS foci. Co-inoculation of helper virus with CaMV gene replacement vectors in which replication was prevented by moving the primer-binding site or by deletion of an essential splice acceptor produced only small, randomly distributed GUS activity foci, demonstrating that the lesion-associated foci were produced by gene expression from replicating constructs. These experiments show that CaMV genes IIIV can be complemented by wild-type virus and replacement gene vectors can be used for transient gene expression studies with CaMV constructs that distinguish gene expression associated with a replicating vector from that associated with a non-replicating vector.
Introduction |
Plant virus vectors have a wide range of potential
applications for studying molecular processes in plant cells, with
successes reported for both DNA and RNA viruses (Timmermans et al.,
1994
; Porta & Lomonossoff, 1996
; Scholthof et al., 1996
). The first plant virus vector was developed
from the pararetrovirus cauliflower mosaic virus (CaMV) (see Gronenborn,
1987
; Covey & Hull, 1992
). CaMV has a circular dsDNA genome of 8 kbp that is
infectious to plants as virion DNA and as cloned DNA. CaMV replacement
vectors have exploited the non-essential gene II, encoding the viral aphid
transmission factor, P2, to achieve systemic replication and expression of
dihydrofolate reductase (Brisson et al., 1984
), interferon (De Zoeten et al., 1989
) and metallothionine (Lefebvre et al.,
1987
). Limitations to the use of CaMV
vectors have included an upper size limit of ~500 bp of foreign DNA and
the requirement for expression of the inserted gene to accommodate the
linked translation of CaMV genes mediated by the viral P6 translational
transactivator gene. A further limitation to the usefulness of systemic
CaMV replacement vectors has been the instability and ejection of inserted
foreign DNA owing to recombinational mechanisms, which probably increases
with larger pieces of non-viral DNA (see Gronenborn, 1987
; Covey & Hull, 1992
). However, CaMV vectors can be used to study small inserts
such as plant introns, which have been inserted into non-essential parts
of gene II (Hohn et al., 1986
), the 35S promoter (Turner et al., 1996
; Noad et al., 1997
) and other genome locations (Pennington & Melcher,
1993
). Transient expression of
non-replicating CaMV constructs has also been used widely, especially in
the analysis of the complex translation strategy of CaMV and its
relationship to the P6 protein (Fütterer & Hohn, 1991
; De Tapia et al., 1993
).
We have been exploring the potential to develop CaMV
vectors capable of expressing relatively large reporter genes like that
for glucuronidase (GUS). Vectors based upon interdependent
complementation of bipartite defective CaMV replicons have not yet been
developed, even though this type of complementation offers promise
(Gronenborn, 1987
; Hirochika &
Hayashi, 1991
). CaMV mutants defective in
movement can also be complemented by wild-type virus during systemic
infection (Thomas et al., 1993
). We have determined whether this type of complementation
can be exploited to express CaMV-based GUS gene vectors. Our
experiments have shown that transient expression of the GUS gene
from a replicating vector in the presence of helper virus is possible and
that this can be distinguished from non-replicative expression of the
reporter gene.
Methods |
Virus and plants. CaMV isolate Cabb B-JI was used as helper virus and as the originator of vector constructs. All inoculations were performed on leaves of Brassica rapa rapifera L. cv. 'Just Right' turnip plants propagated in a containment glasshouse at 1820 °C in a minimum photoperiod of 16 h.
Vector constructs. CaMV replacement vector
pBjigus1 was derived from pCa24, a clone of the CaMV Cabb B-JI genome
inserted into pAT153 at the unique SalI site. The GUS gene
was obtained from plasmid pJJ3431, kindly provided by Jonathan D. G. Jones
(Jones et al., 1992
). A GUS fragment
was isolated following digestion of pJJ3431 with XhoI and
XbaI and this was ligated into pGEM11 (Promega) generating pGemgus.
A linker (Table 1
Table 1. Oligonucleotides used in virus constructs
|
Oligonucleotide |
Sequence (5´ to 3´) |
|
1 |
TCGAGGAGCTCCTAAC |
|
2 |
CATGGTTAGGAGCTCC |
|
3 |
TCGAGT |
|
4 |
CTAGAGCTCATGCA |
|
5 |
TGGTTCATCTTGGAGCGGTCA |
|
6 |
CGATCTCGAGCATCGGTTGACCCGTAATGCTCATAATT |
|
7 |
CTAGCGGATCCGCGGATATCTTTTAAGAGTGGGGGGGTTGGATCCTAG |
|
8 |
CTAGCTAGGATCCAACCCCCCCACTCTTAAAAGATATCCGCGGATCCG |
|
9 |
ATGAATAGGCCTATGACCA |
|
10 |
TGGTCATAGGCCTATTCAT |
|
11 |
CTCTAACGAGATATCCACAGA |
|
12 |
TCTGTGGATATCTCGTTAGAG |
|
13 |
TAATCCGCATATGCCCCCGCTTA |
|
14 |
TAAGCGGGGGCATATGCGGATTA |
|
15 |
TATGGCTAGCCCATGAATAGG |
|
16 |
CCTATTCATGGGCTAGCCA |
|
17 |
TGGTATCAGAGCCATGCTGCAG |
|
18 |
CTGCAGCATGGCTCTGATACCA |
Vector pBjigus2, in which the GUS gene was
inserted immediately after CaMV gene I, was constructed from pBjigus1 as
follows. The bacterial vector pAT153 was first replaced by pGEM5, giving
clone pBjigus1b. A fragment between nucleotides 744 and 1347 was amplified
by PCR with primers (Table 1; oligos 5 and 6) that
produced ends digestible with NsiI and XhoI. A second clone
(pBIB5) comprised the SpeIXhoI (1101644)
fragment of wild-type CaMV. The NsiIXhoI PCR fragment
was used to replace a similar fragment in pBIB5, providing a construct in
which the 5´ portion of CaMV gene II had been deleted, giving clone
pRV4. Plasmid pRV4 was digested with BstEII and XhoI and
ligated to BstEII/XhoI-cut pBjigus1. Since this clone had
lost one of the two plus-strand priming sequences, we re-inserted an
active primer (+ps sequence) at the end of the GUS gene by cloning
a linker (Table 1; oligos 7 and 8) into the
BamHI site of pBjigus2, generating a +ps sequence that we have
shown previously to be active (Noad et al., 1998
).
Construct pPbs2 was produced from the CaMV Cabb B-JI genome by removal of the tRNA primer-binding site (pbs) at position 1, which was then relocated at the end of gene VII at position 333. The starting clone was pG1sbji, the Cabb B-JI genome inserted into pGEM1 at the SalI site. From this, an MluIXhoI fragment was isolated and cloned into pGEM7, to give pG7M-X. Mutagenesis of an A in pG7M-X to a C residue using oligos 9 and 10 (Table 1), thus creating a StuI site at position 22, was achieved with the QuikChange mutagenesis system (Stratagene). Similarly, an A to C change at position 322 created an EcoRV site, using oligos 11 and 12 (Table 1). The resulting clone was digested with DraII and the large fragment re-ligated to give clone pG7m-xM2dra. Mutagenesis with oligos 13 and 14 (Table 1) created an NdeI site at 8011 to give pG7m-xM2draM1. This was digested with NdeI and StuI and a further linker (Table 1; oligos 15 and 16) was inserted following removal of the pbs. This clone was then digested with EcoRV and a new pbs was inserted (Table 1; oligos 17 and 18) to give pG7m-xM2draM3. Following digestion with MluI and XhoI, the fragment was inserted into pG1sbji to give pPbs2. The construct with the mutated pbs elements was combined with pBjigus1 by isolating an NsiI fragment containing the GUS gene and replacing the equivalent fragment in pPbs2 to produce pPbs2gus1.
Inoculations and detection of GUS activity.
Appropriate cloned DNAs were prepared and mixed as necessary.
Co-inoculations contained 1 µg of each DNA; single inoculations
contained 1 µg DNA. Inoculations were in 10 µl TE (10 mM
TrisHCl, pH 7.6, 1 mM EDTA) with 0.03 g/ml Celite abrasive. The
second true leaf of turnip seedlings was inoculated when the leaves were
at least 2 cm long. GUS activity was detected after 7 days by using
X-glucuronide exactly as described previously (Al-Kaff et al.,
1998
). Chlorophyll was removed by treatment of
leaves with 100 % ethanol.
Results |
Transient expression of GUS from a CaMV gene replacement vector
The CaMV
genome (Fig. 1
Fig. 1. CaMV genome and
vector constructs. (a) The circular dsDNA genome of CaMV showing
the location of seven genes (IVII), the 35S and 19S promoters and
the primers for reverse transcription including the primer-binding site
(pbs) for initiation of DNA minus-strand synthesis and the two DNA
plus-strand primers (+ps1, +ps2). (b) Structure of CaMV constructs
represented as the terminally redundant 35S RNA genome relative to the
wild-type 35S RNA. In construct pPbs2, the pbs has been moved to the end of
gene VII. In pBjigus1, the GUS gene replacement was inserted in a
position equivalent to gene III. In pPbs2gus1, the pbs of pBjigus1 was moved
to the end of gene VII. In pBjigus2, the GUS gene replacement was
inserted in a position equivalent to gene II. In 35Sgus, the GUS
gene is regulated by the 35S promoter and Agrobacterium Ti plasmid
octopine synthase transcription terminator (OCSt).
Plasmid DNAs of pCa24GS, a clone of CaMV isolate
Cabb B-JI, and pBjigus1 were digested with the appropriate restriction
enzyme to release the bacterial cloning vectors before inoculation. The
two DNAs were mixed in equimolar proportions and 2 µg samples were
inoculated mechanically onto the first or second true leaves of turnip
seedlings. After 1 week, inoculated leaves had developed local lesions
(usually at least four) typical of CaMV infections following inoculation
with cloned DNA (Table 2
Table 2. Transient GUS activity from CaMV constructs
|
Blue spots (n) |
|||
|
Inoculation |
Local lesions (n) |
In local lesions |
Not in local lesions |
|
Wild-type (wt)* |
6, 8, 8 |
0 |
0 |
|
wt+pBjigus1* |
6, 7, 6 |
3, 4, 3 |
8, 10, 13 |
|
wt+pBjigus2 |
48 |
0 |
>9 |
|
wt+pPbs2gus1 |
48 |
0 |
>8 |
|
pBjigus1 |
0 |
0 |
>5 |
|
pBjigus2 |
0 |
0 |
>5 |
|
pPbs2gus1 |
0 |
0 |
>5 |
|
35Sgus |
0 |
0 |
>9 |
* Data shown are per leaf from three individual leaves in a typical experiment. For the remaining samples, 35 leaves were examined and the minimum number of blue spots per leaf is shown; numbers of non-lesion-associated GUS spots often exceeded 15 per leaf.
Closer inspection of the large lesion-associated blue spots revealed a complex structure, with minor satellite spots of GUS activity around the central multicellular zone (Fig. 3 e, f). The sizes of blue spots and their location in lesions suggested that the GUS gene vector had undergone limited replication and spread to a few adjacent cells complemented by the wild-type helper virus. However, we could not discount the possibility that substrate product had leaked to adjacent cells from a single cell containing the reporter enzyme. In control inoculations with pBjigus1 DNA alone, we were surprised to see several small foci of GUS activity on each inoculated leaf, presumably limited to single cells (Fig. 3 g). In different experiments, the number of background blue spots varied but was usually more than five per leaf, and there were often up to twenty per leaf, but the total number was difficult to determine because of their small size in relation to that of the leaf.
GUS expression from replicating and non-replicating gene vectors
The above experiments suggested that a replication-defective CaMV construct containing a GUS gene could show expression following manual inoculation of leaves with vector DNA. The relatively small size of the background blue foci following inoculation of pBjigus1 DNA alone showed that measurable GUS activity was limited to one or a few cells, with little or no local movement of blue product to adjacent cells. As a positive control for localized GUS activity, we inoculated leaves with DNA of a simple 35SGUSoctopine synthase terminator construct (Fig. 1). Blue spots were observed after 1 week and were generally similar in size and distribution to those seen following single pBjigus1 inoculations (Fig. 3 h). No difference in the pattern of GUS expression was observed when DNAs were inoculated as linearized or supercoiled forms (data not shown).
Fig. 2. Junction sequences
of constructs. (a) Wild-type CaMV in gene II showing the DNA
plus-strand primer (+ps2) upstream of the XhoI insertion site.
(b) After insertion of the GUS gene in wild-type DNA,
producing construct pBjigus1. (c) The gene IGUS
junction in pBjigus2. (d) Wild-type sequence in the region of the
pbs and gene I. (e) After movement of the pbs in construct
Pbs2.
We next wanted to show that the often larger zones of GUS activity located in the centres of local lesions following co-inoculation with wild-type virus had resulted from vector replication complemented by wild-type helper virus. The wild-type CaMV genome was modified by moving the pbs origin of reverse transcription from its normal location at the beginning of gene VII to the end of gene VII, generating construct pPbs2 (Fig. 1 b). Inoculation of plants with pPbs2 resulted in no symptoms, from which we concluded that it was not infectious. The same mutation was then introduced into pBjigus1 and the construct (pPbs2gus1) was co-inoculated with wild-type virus. In this case, no large or small blue spots were observed in local lesions centres, but background blue spots were found following chlorophyll removal (Table 2). This shows that the lesion-associated blue spots result from expression of replicated pBjigus1 following complementation by wild-type helper virus. We have found that local lesion-associated foci of GUS activity varied in size between large and small, with the latter being indistinguishable in size from the background non-lesion-associated blue spots. Thus, the size of blue foci was not used as a primary measure of replicative competence of a construct but rather its frequency of association with lesion centres.
Evidence that a CaMV splice acceptor produces a molecule with a cis-acting function
We were intrigued by the non-replicative expression of
pBjigus1, since the GUS gene was internal in an equivalent position
to CaMV gene III. Expression of the CaMV genome is complex and involves
linked translation of internal genes mediated by the gene VI protein P6, a
translational transactivator (Fütterer & Hohn, 1991
; De Tapia et al., 1993
; Hohn & Fütterer, 1997
). Splicing is also an essential part of the
CaMV replication cycle (Kiss-László et al., 1995
), although its specific involvement in
expression of particular CaMV genes is not understood. A spliced RNA
molecule has been detected in plants in which a splice donor in the 35S
RNA leader (Kiss-László et al., 1995
) was fused to an acceptor site at 1508, located
within gene II. Since mutagenesis of the 1508 splice acceptor abolishes
CaMV infectivity, it has been suggested that the leader-to-1508 spliced
molecule is a possible subgenomic mRNA for the essential CaMV gene III. To
apply our transient expression system to this problem, we made a construct
in which the GUS gene replaced the complete gene IIgene V
sequence in such a way as to remove the splice acceptor at 1508, in
construct pBjigus2 (Fig. 1 b). Since the gene
III protein, P3, is produced by the wild-type helper virus to complement
the missing protein in the vector, this should negate the requirement for
the 1508 splice acceptor in pBjigus2. Leaves were co-inoculated with
pBjigus2 and wild-type helper virus, with the expectation of observing
lesion-associated GUS activity spots. However, in several experiments, we
never observed lesion-associated GUS activity following co-inoculation
with these constructs but found only background, non-lesion-associated,
small blue spots (Fig. 3 i; Table 2), from which we conclude that GUS
expression had occurred in the absence of vector replication.
Fig. 3. Expression of
GUS gene activity 1 week after inoculation of turnip seedlings with
various constructs. (a)(f) Co-inoculation of wild-type
helper virus with pBjigus1, before (a, c) and after
(b, df) removal of chlorophyll. l, Local lesion;
lb, lesion containing a central zone of GUS activity.
(g)(i) Small
non-lesion-associated blue spots produced by single inoculations with
pBjigus2 (g), 35SGUS (h) and
co-inoculation of wild-type and pBjigus2 (i) are labelled sb. Bars represent
approx. 1 mm.
Discussion |
We have developed a virus helper-dependent vector
system that expresses the largest transgene so far reported from a CaMV
replicon. The GUS reporter gene replacements encompassed CaMV genes
IIV, demonstrating complementation of essential functions associated
with CaMV structural proteins P3 and P4 and at least one component of the
viral reverse transcriptase (P5). The helper-dependent vector was also
capable, apparently, of limited cell-to-cell movement. These conclusions
are based upon the observation that GUS expression was located in
the centres of local lesions following co-inoculation with wild-type
helper virus. Moreover, an area up to half the diameter of the local
lesions, although often less extensive than this, contained the vector
expressing the reporter gene. Further movement and expression of the
vector was presumably restricted through competition by wild-type virus.
We have attempted to extend expression of the vector by making
helper-virus constructs disabled in P1 expression (Thomas et al.,
1993
), but co-inoculation rapidly led to
generation of wild-type virus by recombination (our unpublished results).
Unexpectedly, we found that inoculation of GUS vector constructs alone,
which presumably lack the ability to replicate, showed reporter gene
expression, most likely limited to single or a few cells that were not
associated with local lesions. This has enabled us to distinguish
replication-associated reporter activity from non-replicative expression.
Co-inoculation of helper virus with a replication-defective vector in
which the pbs origin of reverse transcription (Turner & Covey, 1984
) had been moved showed limited
non-lesion-associated GUS activity.
Fig. 4. Possible routes of
CaMV gene expression. (a) In wild-type CaMV, it is hypothesized
that gene II expression could be transactivated by the gene VI protein,
with gene III expressed from a subgenomic mRNA produced from a splice
between a donor (sd) in the 35S RNA leader and an acceptor (sa) in gene
II. With this hypothetical scheme, the GUS gene in construct pBjigus1
(b) could be expressed after an RNA splice and, in pBjigus2
(c), by P6 transactivation.
The observations of expression of the GUS
gene as an internal open reading frame of the CaMV vector, even in the
absence of helper virus, suggests strongly that RNA processing or
expression of other viral genes had occurred. Translation of internal open
reading frames can occur through the activity of the CaMV P6 translational
transactivator protein (Fütterer & Hohn, 1991
). However, it is not clear which CaMV genes are expressed
by this process during virus replication in vivo. This is
complicated further by the discovery of multiple splice donor and acceptor
sequences in the 5´ third of the genomic 35S RNA transcript.
Moreover, a splice donor within the non-essential gene II at position 1508
is apparently essential for virus replication (Kiss-László
et al., 1995
). Thus, expression of
CaMV gene II might be expected to occur by P6-mediated translational
transactivation, with gene III expression resulting from a splice between
a donor site in the 35S RNA leader sequence at position 7909 and the
essential acceptor in gene II at 1508 (see Fig.
4
We thank the John Innes Foundation for a PhD studentship to R. V. and the BBSRC for grant-aided support to the John Innes Centre. We also thank Professor J. W. Davies for helpful comments. This work was carried out under MAFF licence PHL 11B/3013(3/1999).
References |
© 2000 SGM
This article is now available in the January 2001 print issue of JGV (vol. 82, 5965). The complete issue of the journal may be seen in electronic form on JGV Online.