| Journal of General Virology |
| SUMMARY | INTRO | METHODS | RESULTS | DISCUSSION | FOOTNOTES | REFS |
| First posted online 30 June 2000 | FULL-LENGTH ARTICLE |
| Rec 17 March 2000; Acc 19 June 2000 | DOI: 10.1099/vir.0.17048-0 |
Xiaojiang Dai,1,2 József P. Hajós,1,3 Nina N. Joosten,1 Monique M. van Oers,1 Wilfred F. J. IJkel,1 Douwe Zuidema,1 Yi Pang2 and Just M. Vlak1
1 Laboratory of Virology,
Wageningen University and Research Centre, Binnenhaven 11, 6709 PD
Wageningen, The Netherlands
2 State Key Laboratory for Biocontrol and Institute of
Entomology, Zhongshan University, Guangzhou 510275, People's Republic of
China
3 Institute of Enzymology, Biological Research Centre,
Hungarian Academy of Sciences, PO Box 7, 1518 Budapest, Hungary
When Spodoptera exigua multicapsid nucleopolyhedrovirus (SeMNPV) is grown in insect cell culture, defective viruses are generated. These viruses lack about 25 kbp of sequence information and are no longer infectious for insects. This makes the engineering of SeMNPV for improved insecticidal activity or as expression vectors difficult to achieve. Recombinants of Autographa californica MNPV have been generated in insects after lipofection with viral DNA and a transfer vector into the haemocoel. In the present study a novel procedure to isolate SeMNPV recombinants was adopted by alternate cloning between insect larvae and cultured cells. The S. exigua cell line Se301 was used to select the putative recombinants by following a green fluorescent protein marker inserted in the p10 locus of SeMNPV. Polyhedra from individual plaques were fed to larvae to select for biological activity. In this way an SeMNPV recombinant (SeXD1) was obtained with the speed of kill improved by about 25 %. This recombinant lacked 10593 bp of sequence information, located between 13.7 and 21.6 map units of SeMNPV and including ecdysteroid UDP glucosyl transferase, gp37, chitinase and cathepsin genes, as well as several genes unique to SeMNPV. The result indicated, however, that these genes are dispensable for virus replication both in vitro and in vivo. A mutant with a similar deletion was identified by PCR in the parental wild-type SeMNPV isolate, suggesting that genotypes with differential biological activities exist in field isolates of baculoviruses. The generation of recombinants in vivo, combined with the alternate cloning between insects and insect cells, is likely to be applicable to many baculovirus species in order to obtain biologically active recombinants.
Introduction |
The beet army worm Spodoptera exigua causes
extensive economic losses in many cultivated crops throughout the
temperate and subtropical regions of the Northern hemisphere and in
greenhouses. The insect is resistant to many commonly used chemical
insecticides. S. exigua multicapsid nucleopolyhedrovirus (SeMNPV)
is an attractive bio-insecticide since the virus is monospecific to the
beet army worm and highly virulent as compared to other baculoviruses
(Smits et al., 1988
). It has also been
commercialized as a bio-insecticide (Smits & Vlak, 1994
). However, further improvements in the
biological activity of SeMNPV are sought, either by strain selection
(Muñoz et al., 1998
) or by genetic engineering.
The molecular genetics of SeMNPV have been
relatively well studied. A detailed physical map has been constructed
(Heldens et al., 1996
) and a number of SeMNPV genes have been characterized in
detail (van Strien et al., 1992
, 1996
, 1997
; Zuidema et al., 1993
; Heldens et al., 1997
). Recently the complete sequence and gene
organization of the SeMNPV genome have been reported (IJkel et al.,
1999
). However, the molecular basis for
specificity and virulence has not yet been revealed.
Several cell lines have been derived from
S. exigua, such as SeUCR (Gelernter & Federici, 1986
a
), Se301 (Hara et al., 1995
b
) and IZD2109 (B. Möckel,
personal communication), and susceptibility to SeMNPV has been reported
(Hara et al., 1993
, 1995 a
). However, when SeMNPV is grown in insect cell
culture defective viruses are quickly generated (Heldens et al.,
1996
). The majority of these viruses
lack about 25 kbp of sequence information and are no longer infectious for
insects. The deletion is located approximately between 12.9 and 32.3 map
units (m.u.) and encompasses the SeMNPV open reading frames (ORFs) 15 to
41 (IJkel et al., 1999
). This makes the engineering of SeMNPV for improved
insecticidal activity or as expression vectors difficult to achieve. The
generation of defective viruses in cell culture limits the structural and
functional analysis of the SeMNPV genes and the isolation of recombinants
with adequate infectivity in vivo and in cell culture.
SeMNPV has been isolated from many different
geographical regions throughout the world (Vlak et al., 1981
; Gelernter & Federici, 1986 b
; Hara et al., 1995 a
; Muñoz et al., 1998
). Wild-type (wt) SeMNPV isolates consisting of
several genotypic variants are frequently found. This is typically
indicated by the presence of submolar bands in restriction endonuclease
digestion profiles of viral DNA (Muñoz et al., 1998
, 1999
). Isolation of individual genotypic variants by in
vivo cloning methods (Smith & Crook, 1988
) has allowed the evaluation of the relative virulence of
the different genotypic variants (Muñoz et al., 1998
, 1999
). Since multiple passaging of SeMNPV in cultured insect
cells results in the generation of defective viruses (Heldens et
al., 1996
), cloning of genotypic variants of
SeMNPV is difficult to obtain by conventional plaque purification
techniques. Hence, a novel strategy was adopted in this study to generate
genotypic variants of SeMNPV by cloning alternately in vivo and
in vitro.
We previously reported that recombinants of
Autographa californica (Ac) MNPV were successfully generated in
S. exigua larvae by transfection of viral and transfer vector DNA
into the haemocoel by lipofection (Hajós et al., 1998
). In this study we used a similar strategy to
generate recombinants of SeMNPV. We also adopted a novel procedure to
isolate SeMNPV recombinants by cloning alternately between S.
exigua larvae and Se301 cultured cells to secure in vivo and
in vitro infectivity. By this strategy an SeMNPV recombinant
(SeXD1) was generated using green fluorescent protein (GFP) as a screening
marker. This recombinant had a similar genetic make-up to one of the
variants observed in the SeMNPV isolates and was able to replicate both
in vivo and in cultured insect cells. However, it lacked 10.6 kbp
of nucleotide sequence as compared to the complete SeMNPV genome.
Bioassays indicated that the recombinant has superior speed of kill as
compared to the wt isolate.
Methods |
Virus, insects and cells. The SeMNPV-US1
isolate (Gelernter & Federici, 1986 b
) was originally obtained from B. A. Federici (Department
of Entomology, University of California, Riverside, CA, USA) in the form of
polyhedra and propagated in fourth instar S. exigua larvae (Smits
et al., 1988
). Cultures of S.
exigua were reared on an artificial diet at 27 °C, 70 % humidity
and a 16:8 h photoperiod. The S. exigua cell lines Se301
(Hara et al., 1995 b
) and SeUCR (Gelernter & Federici, 1986 a
) were donated by T. Kawarabata (Institute of
Biological Control, Kyushu University, Japan) and B. A. Federici,
respectively. All cells were propagated at 27 °C in Grace’s
supplemented medium containing 10 % foetal calf serum (FCS; Gibco). Viral
DNA used for the generation of recombinant viruses and restriction
endonuclease analysis was extracted from polyhedra produced in S.
exigua larvae by standard methods (O'Reilly et al., 1992
).
Construction of an SeMNPV p10
promoter-based transfer vector for GFP expression. The SeMNPV 5.1 kbp
XbaI H fragment containing the p10 gene flanked by
p26 and p74 sequences (Zuidema et al., 1993
; IJkel et al., 1999
) was used as a basis for the construction of an SeMNPV
p10 promoter-based transfer vector (Fig. 1). A
1448 bp EcoRIBamHI fragment was derived from the
XbaI H fragment and cloned into pUC19 (pSeMO2). The BamHI
and XbaI sites located at one end of the insert were both removed
by filling in with Klenow, resulting in plasmid pSeMO4. The 5´
flanking sequence of the SeMNPV p10 locus, containing the 3´
end of the p26 gene and the p10 promoter, was isolated by
PCR with the forward primer M13 and a specific antisense primer (5´
TCTAGACCTAAGGGATCCTAATGTATAATATAATTAC 3´) using pSeMO4 as
template. With this PCR a BamHI site was introduced immediately
downstream of the adenosine residue of the p10 translational start
codon. The PCR product was cloned into pUC19 as a 513 bp
EcoRIBamHI fragment (pSeMO5) and its identity was
verified by sequence analysis. A second PCR was performed on pSeMO4 with
the reverse M13 primer and a sense primer (5´
GGATCCCTTAGGTCTAGATAAAACTTAACGACGACG 3´) to generate the
3´ flanking region of the transfer vector containing the p10
3´ untranslated region and the 3´ end of the p74 gene.
With this PCR an XbaI site was generated immediately upstream of
the p10 translational stop codon TAA. The PCR product was cloned
into pUC19 as a 680 bp XbaIHindIII fragment (pSeMO6).
Sequence analysis showed the correct sequence between the introduced
XbaI site and the internal ClaI site. A three-point ligation
was performed to bring the 5´ and 3´ flanking regions of the
p10 gene together, separated by BamHI and XbaI sites.
An approximately 3.2 kbp EcoRIClaI fragment of pSeMO4,
containing pUC19 sequences and part of the 3´ flanking sequence, was
combined with the 513 bp EcoRIBamHI fragment of pSeMO5
and the 130 bp BamHIClaI fragment of pSeMO6 to give
pSeMO7. In this new vector the BamHI site is juxtaposed to the
XbaI site. Finally, a 747 bp BamHI fragment containing the
GFP ORF derived from pUC19 GFP (Reiländer et al., 1996
) was cloned into the BamHI site of
pSeMO7 to give the transfer vector pSeXD1.
Fig. 1. Schematic representation of the
p10 locus in SeMNPV and in the p10-based transfer vectors
pSeMO7 and pSeXD1. Plasmid pSeMO2 contains a 1448 bp
EcoRIBamHI fragment derived from the XbaI H
fragment of SeMNPV containing the p10 locus and its flanking
sequences. Plasmid pSeMO7 is the empty SeMNPV p10 promoter-based
transfer vector. In plasmid pSeXD1 the ORF for the green fluorescent
protein (gfp) is present downstream of the p10 promoter. Pp10,
p10 promoter; 3´UTR, p10 3´ untranslated region
including a poly(A) motif; B, BamHI; C, ClaI; E,
EcoRI; H, HindIII; X, XbaI.
Generation of an SeMNPV
p10 recombinant expressing GFP. An SeMNPV
recombinant was generated by injection of viral and transfer vector DNA
into the haemocoel of fourth instar S. exigua larvae according to
Hajós et al. (1998
) followed by alternate cloning between S. exigua
larvae and Se301 cells. The injection into insect larvae was performed
using a 1.5 ml volume B-D Pen (Becton & Dickinson) and 28-gauge
half-inch NovoFine needles (Novo Nordisk). The injection solution was
added to 1.5 ml injector cartridges (Eli Lilly) in a sterile hood
(Hajós et al., 1998
). Twenty µl of the cotransfection solution containing
0.4 µg circular SeMNPV DNA and 12 µg transfer vector pSeXD1 DNA,
and 30 % Cellfectin (Gibco-BRL) were injected into the haemocoel of each
larva. Haemolymph was obtained from a cut proleg 3 days post-transfection
and added to 5 ml of serum-free Grace’s medium containing a few crystals
of phenylthiourea, filtered through a 0.45 µm filter (Schleicher
& Schuell) and stored at 80 °C. The haemolymph filtrate was
tested for virus titre and the relative proportion of wt and recombinant
SeMNPV by plaque assay determinations (O'Reilly et al., 1992
). The assays were scored for fluorescence under
a UV microscope.
Recombinant plaques were selected by their GFP expression and each plaque was diluted with 200 µl Grace's medium without FCS to elute extracellular virus. The virus was amplified in a 24-well plate by adding 100 µl of the plaque eluate to a well with approximately 2x104 Se301 cells. Wells with polyhedra-containing cells were harvested 3 days post-infection (p.i.) and the cells were suspended in 12 µl distilled water. S. exigua third instar larvae were then orally fed after adding the cell suspensions of each well onto Chrysanthemum leaf discs with a diameter of 4 mm and placed in 6-well tissue culture plates containing 1 ml 1.5 % agarose layer to prevent desiccation. One larva was put in each well with one leaf disc. After consumption of the leaf disc (approx. 16 h) the larvae were placed on an artificial diet. Haemolymph was collected at 3 days p.i. from larvae showing infection symptoms (lethargy, impaired locomotion, pale appearance, no food consumption) and used to measure virus titre and to perform a second round of plaque purification. After three rounds of alternate in vivo and in vitro cloning, the SeMNPV recombinants were amplified in fourth instar S. exigua larvae.
SDSPAGE and Western blot analysis.
Se301 cells were infected at an m.o.i. of 10 with wt SeMNPV and the
recombinant (SeXD1), respectively. Infected cells were harvested at 48 h
p.i. and the proteins were analysed by electrophoresis in a 12.5 %
SDSpolyacrylamide gel using a Bio-Rad Mini-Protein II apparatus.
Western blot analysis was performed with a GFP antibody (Molecular Probes)
(1:2000 diluted) by standard methods (Sambrook et al., 1989
).
PCR, cloning and sequencing. To analyse
deletions in the SeMNPV PstI D fragment, a PCR was performed with
the Expand Long Template PCR system (Boehringer Mannheim) using forward
primer A (5´ GTAGGGGACGCGAATTTGACTGTTGTTGCAG 3´) and reverse
primer B (5´ CGCACGCTCCACGCTACTCGACTTTGATA 3´), corresponding to
nt 17874 to 17904 and 29135 to 29163 of the SeMNPV genome (IJkel et
al., 1999
), respectively. The PCR products
were cloned into pGEM-T (Promega) and sequence reactions were performed at
the Sequencing Core Facility of Eurogentec using universal
primers.
Bioassays. The infectivities of wt SeMNPV
and recombinant SeXD1 were determined in a leaf disc bioassay as described
by Bianchi et al. (2000
). Chrysanthemum leaf discs were prepared using a
cork borer with a diameter of 9 mm and placed individually in a 12-well
tissue culture plate containing 1 ml 1.5 % agarose. Droplets (3 µl)
of polyhedra suspensions containing 0 (control), 3x103,
104, 3x104, 105, 3x105
polyhedra/ml were applied to each leaf disc and dried using a fan. One
third instar S. exigua larva was added per well. For each dose 36
larvae were used. Larvae that consumed the whole leaf disc within 24 h
were transferred to a 12-well tissue culture plate containing fresh
artificial diet and were further reared at 27 °C. Mortality was
recorded daily until all larvae had either pupated or died due to SeMNPV
infection. The bioassay was performed in three repetitions.
The speed of action of wt SeMNPV and the recombinant
SeXD1 was determined in a modified droplet-feeding bioassay (Hughes &
Wood, 1981
). Third instar S. exigua
larvae were starved for 16 to 20 h at 27 °C prior to bioassaying. The
larvae were allowed to drink from an aqueous suspension containing 10 %
(w/v) sucrose, 0.001 % (w/v) SÄURE-blue and polyhedra at
concentrations of 0 (control), 103, 3x103,
104, 3x104, 105 polyhedra/ml. The first
36 larvae that drank from the solution within 10 min were transferred to
individual wells of three 12-well tissue culture plates with a fresh
artificial diet. Larvae were reared at 27 °C, and mortality was
recorded every 12 h until all larvae had either pupated or died. The
bioassay was performed in four repetitions. Dosemortality data were
analysed with the computer program POLO (Russell et al., 1977
). For the calculation of LD50
values, median ingested volumes of 0.55 µl for third instar S.
exigua larvae were used, as measured by Bianchi et al. (2000
). Median survival times (ST50) were
calculated using the Vistat program (version 2.1; Boyce Thompson Institute,
Cornell University, Ithaca, NY, USA). Log LD50 and
ST50 values were analysed by regression analysis and
t-tests of pairwise differences between treatments with Genstat
(Payne et al., 1993
).
Results |
Generation of p10 recombinant SeXD1
To generate a
p10 SeMNPV recombinant, the transfer vector pSeXD1
carrying a GFP marker gene was constructed (Fig. 1).
The size of transfer vector pSeXD1 was 4.6 kbp, and it contained 503 bp
upstream (including the p10 promoter) and 673 bp downstream
[including the p10 poly(A) motif; van Oers et al., 1999
] of the SeMNPV p10 ORF, and the 747 bp
GFP gene driven by the authentic p10 promoter.
Seventeen fourth instar larvae were injected with wt
SeMNPV and pSeXD1 DNA at a ratio of 1:30 µg, corresponding to a molar
ratio of approximately 1:800. Sixteen larvae survived the injection
treatment. The haemolymph from these 16 larvae was transferred to 5 ml of
Grace's medium without FCS. The controls included larvae injected with
only viral DNA, only transfer vector DNA, only Cellfectin and untreated
larvae. Plaque assays indicated that the total virus titre of the
haemolymph was 3.7x104 p.f.u./ml. The percentage of
recombinants was approximately 3.3 %, in agreement with data obtained
previously for AcMNPV (Hajós et al., 1998
). The GFP gene driven by the p10
promoter of SeMNPV induced bright fluorescence, as observed with a UV
microscope. With the help of GFP, it was easy to screen by fluorescence
and pick recombinant plaques from Se301 cells. Several recombinant viruses
were isolated by three rounds of alternate cloning between third instar
S. exigua larvae and Se301 cells (see Methods). Finally,
recombinant SeXD1 was amplified in fourth instar S. exigua larvae
and analysed.
To confirm the location of the GFP gene insertion,
recombinant SeXD1 DNA was examined by SpeI restriction endonuclease
digestion. The SeMNPV p10 gene is located on the 4.5 kbp
SpeI I fragment corresponding to nt 122885 to 127355 of the genome
(Fig. 2 A) (IJkel et al., 1999
). When the 264 bp p10 ORF (corresponding
to nt 123740 to 124006) is replaced with the 747 bp GFP gene ORF, the
SpeI I fragment would become 5.0 kbp (Fig. 2
A). As shown in Fig. 2(B), the SpeI restriction
endonuclease pattern of SeXD1 confirmed the insertion of the GFP ORF into
the p10 locus in SeXD1. SDSPAGE and Western blot analysis
showed the absence of the P10 protein, while GFP was expressed in both
Se301 and SeUCR cells infected with SeXD1 (Fig. 2 C
and D, lanes 3 and 6).
Fig. 2. Construction and analysis of SeXD1, a
p10 SeMNPV recombinant expressing GFP. (A)
Construction of SeXD1. The top line represents the physical map of the wt
SeMNPV genome for SpeI restriction endonuclease. p10 is
located in the 4.5 kb SpeI I fragment (corresponding to nt 122885
to 127355). The 264 bp p10 ORF (corresponding to nt 123740 to
124006) was replaced with the 747 bp GFP gene; the SpeI I fragment
became 5.0 kb in SeXD1. (B) SpeI restriction endonuclease analysis
of genomic DNAs from wt SeMNPV and SeXD1. (C) and (D) SDSPAGE and
Western blot analysis using anti-GFP antibodies. Uninfected Se301 cells
(lane 1), Se301 cells infected with wt SeMNPV (lane 2) and with SeXD1
(lane 3), uninfected SeUCR cells (lane 4), SeUCR cells infected with wt
SeMNPV (lane 5) and with SeXD1 (lane 6). PH, polyhedrin.
Uninfected Se301 cells are shown in Fig. 3 (A). At 16 h p.i., polyhedra were observed in about 20 % of the Se301 cells infected with either wt SeMNPV or SeXD1 at an m.o.i. of 10 (data not shown). At 48 h p.i., polyhedra were observed in about 90 % of the Se301 cells infected with wt SeMNPV (Fig. 3 B) and in almost 100 % of Se301 cells infected with SeXD1 (Fig. 3 C). Bright fluorescence was observed in SeXD1-infected Se301 cells under the UV microscope (Fig. 3 D). No fluorescence was observed either in wt SeMNPV-infected or in uninfected Se301 cells (data not shown).
Fig. 3. Phase-contrast and UV micrographs of
the S. exigua cell line Se301. Se301 cells (A) were infected with
wt SeMNPV (B) and with SeXD1 (C and D) at 48 h p.i. Polyhedra were
observed in phage contrast images of wt SeMNPV (B) and SeXD1-infected
cells (C). The expression of GFP in SeXD1-infected cells is shown by
irradiation with UV light (D).
Thus, UV microscopy, restriction enzyme analysis, SDSPAGE and Western blot analysis demonstrated that the recombinant virus SeXD1 lacked the p10 gene and expressed GFP. This recombinant was able to complete its replication cycle both in S. exigua larvae and in the cultured cell lines Se301 and SeUCR.
Analysis of deletion mutants
Wt SeMNPV is made up of
several genotypic variants (Muñoz et al., 1998
, 1999
) and replication of SeMNPV in cultured cells often results
in the generation of deletion mutants (Heldens et al., 1996
). To determine whether the recombinant SeXD1 is
one of these variants, SeXD1 as well as wt SeMNPV were analysed with
restriction endonucleases. The SpeI and PstI digestions
showed several submolar bands in wt SeMNPV (Figs 2 B
and 4 B), indicating that the wt SeMNPV isolate is a
mixture of genotypes. No submolar bands were found in the SpeI and
PstI digestion patterns of SeXD1 DNA (Figs 2 B
and 4 B). However, the PstI D, SpeI E
and SpeI H fragments were absent in SeXD1 (Figs 2 B and 4 B), suggesting that
although SeXD1 is genetically homogeneous it might be a deletion mutant.
One of the submolar bands found after SpeI digestion of wt SeMNPV
(Fig. 2 B) is a molar band in the recombinant,
suggesting that a variant with a similar deletion is present in wt
SeMNPV.
Fig. 4. Analysis of the deletion mutants. (A)
The top line represents the physical map of the wt SeMNPV genome for
PstI restriction endonuclease. A 10593 bp fragment, including
egt, v-cath, gp37, chiA, etc. (corresponding
to nt 18513 to 29106; dashed horizontal line), was deleted in the
recombinant SeXD1. The deletion in a genotypic variant of wt SeMNPV was
also from nt 18513 to nt 29106 (a total of 10593 bp). (B) PstI
restriction endonuclease analysis of genomic DNAs from wt SeMNPV and
SeXD1. The PstI D fragment was absent in SeXD1. (C) PCR analysis of
genomic DNAs from wt SeMNPV and SeXD1. The primers A and B correspond to
nt 17874 to 17904 and 29135 to 29163, respectively.
To determine in more detail which region was absent, both SeXD1 and wt SeMNPV DNA were examined by PCR amplification. The restriction analysis had shown the absence of the PstI D fragment in SeXD1, while the neighbouring fragments L and C were retained (Fig. 4 A, B). Therefore, PCR primers were designed annealing approximately 100 bp up- and downstream of the PstI D fragment in fragments L and C, respectively (see Methods). In an amplification from complete genomic SeMNPV DNA the PCR product should be 11289 bp, and a product of this size was indeed observed (Fig. 4 A). Amplification from SeXD1 DNA, however, resulted in a single approximately 700 bp product (Fig. 4 C), suggesting that about 10 kbp was deleted from SeXD1. PCR analysis also indicated that SeXD1 most likely contained a single genotype. Amplification using wt SeMNPV DNA as template resulted in at least five products, including 11 kbp, 2.8 kbp, 2.0 kbp, 1.2 kbp and 700 bp products (approximate sizes; Fig. 4 C). These results suggested that the wt SeMNPV is a mixture containing several deletion mutant variants in this locus. Conclusions about the relative amounts of the variants cannot be drawn from this analysis, however, since smaller fragments are likely to be amplified more efficiently than larger ones.
The approximately 700 bp product was observed in both SeXD1 and wt SeMNPV (Fig. 4 C), implying that SeXD1 might have originated from one particular genotypic variant in the wt SeMNPV isolate. To exactly locate the deleted region and to compare SeXD1 with wt SeMNPV, the approximately 700 bp fragments from both SeXD1 and wt SeMNPV were cloned into pGEM-T and sequenced. Sequence analysis showed the presence of both primers in the PCR products and mapped the deletion of SeXD1 from 13.7 to 21.6 m.u. (10593 bp, from nt 18513 to nt 29106) (Fig. 4 A). The deletion in a genotypic variant of wt SeMNPV was also from nt 18513 to nt 29106, a total of 10593 bp (Fig. 4 A). A total of 12 ORFs were completely deleted, encompassing SeMNPV ORFs 16 to 27 and including ecdysteroid UDP glucosyl transferase (egt), gp37, chitinase (chiA), cathepsin (v-cath), ptp-2 and nine others. Two ORFs, ORF 15 and 28, were partially deleted. Therefore, the sequences maintained in SeXD1 and in one of the wt SeMNPV variants were the same, suggesting that SeXD1 is derived from an existing genotypic variant of wt SeMNPV.
SeXD1 was passaged in Se301 cells several times when purified but still retained the same deletion as its parental wt SeMNPV. The result indicated that the genotypic variant with a deletion of 10593 bp was quite stable. The result also indicated that naturally egt-deleted, gp37-deleted, chiA-deleted and v-cath-deleted genotypes existed in the wt SeMNPV population and that none of the deleted genes are required for viral DNA replication either in vivo or in vitro.
Biological activity and symptomatology of virus-infected S. exigua larvae
The insecticidal activities of the recombinant SeXD1 and wt SeMNPV were determined for third instar S. exigua larvae in terms of LD50 and ST50 (Table 1). The ST50 value of SeXD1 (70.2 h) was 25 % lower than that of wt SeMNPV (93.1 h). The ST50 value was significantly different (P<0.05). The slopes of the filled timemortality relationships were not significantly different for both viruses.
The LD50 value of SeXD1 [403 occlusion bodies (OBs)/larva] was approximately three times higher than that of wt SeMNPV (125 OBs/larva), but this was not significantly different (P=0.094) (Table 1). The slopes of the filled dosemortality curves were not significantly different (P=0.05).
Table 1. Dosemortality (LD50) and lethal timemortality (ST50) of wt SeMNPV and recombinant SeXD1 for third instar S. exigua larvae
The data in the table came from the statistical analysis. The LD50 was determined in three repetitions by a leaf disc bioassay and the ST50 in four repetitions by a droplet-feeding bioassay.
|
Viruses |
Log LD50 |
LD50 (OBs/larva) |
Slope |
ST50 (h) |
Slope |
|
wt SeMNPV |
4.83a±0.68 |
125a |
1.50a±0.32 |
93.1b±5.9 |
10.92a±3.86 |
|
SeXD1 |
6.00a±1.15 |
403a |
1.26a±0.34 |
70.2b±6.7 |
9.17a±2.16 |
a, No significant difference; b, significantly different.
There were some differences in symptoms of wt SeMNPV
and SeXD1-infected S. exigua larvae. The larvae infected with wt
SeMNPV became pale and creamy in colour prior to death. After death
infected insects rapidly liquefied. A small proportion of the wt
SeMNPV-infected larvae turned black before liquefaction. The larvae
infected with SeXD1 also became pale prior to death but all larvae turned
black. In addition, the SeXD1-infected larvae did not liquefy after death
and remained physically intact (data not shown), a typical phenotype of
infection with a baculovirus lacking cathepsin and/or chitinase (Slack
et al., 1995
; Hawtin et al.,
1997
).
Discussion |
Replication of SeMNPV in cultured cells results in
the generation of deletion mutants which are not infectious to S.
exigua larvae (Heldens et al., 1996
). This is the major reason why engineering of SeMNPV has
been difficult to achieve in the past several years. Based on the
successful generation of AcMNPV recombinants by cotransfection of viral
and transfer vector DNA into the haemocoel of S. exigua larvae
(Hajós et al., 1998
), and the supposition that a few intact SeMNPV would
survive one or two passages in cultured cells, we adopted a procedure to
engineer SeMNPV by alternate cloning between insect larvae and cultured
cells. When the molar ratio between viral DNA and transfer vector was
1:30, recombinants were observed at 3.3 %. This is in the same order of
magnitude as in the case of AcMNPV, where approximately 2 % has been
recorded (Hajós et al., 1998
). Although the same amount of viral DNA per larva (0.4
µg) was used in the injection, the total virus titre in the
haemolymph of the cotransfected larvae is much lower (3.7x104
p.f.u./ml) than found for AcMNPV (5.2x108 p.f.u./ml)
(Hajós et al., 1998
). The result suggests that the transfection with SeMNPV
DNA is less efficient than with AcMNPV DNA, but that the relative
proportion of recombinants is more or less similar.
A wt SeMNPV isolate is made up of several genotypic
variants; some of these contain large deletions and are helper-dependent
(Muñoz et al., 1998
, 1999
). PCR and sequence
analysis showed that in the recombinant SeXD1 10593 bp of the SeMNPV
sequence was deleted (Fig. 4 A, C). The same procedure
revealed the presence of a genotype with a deletion of the same size in wt
SeMNPV (Fig. 4 C). The question is whether the SeMNPV
deletion naturally exists in the wt SeMNPV population or results from the
passages in cultured cells. Since it was reported that extensive deletions
in the SeMNPV genome occurred very quickly in the SeUCR cell line (Heldens
et al., 1996
), it was generally
thought that SeMNPV would loose its pathogenic effect in vivo after
just one passage with multiple replication cycles in cultured cells and
that it would be difficult to obtain SeMNPV variants that retained
biological activity in vivo from cultured cells. However, with this
novel approach we successfully selected several SeMNPV recombinants
infectious in vivo and in vitro, one of which, SeXD1, was
analysed in detail.
Restriction endonuclease and PCR analysis showed the
presence of several other genotypes in wt SeMNPV (Figs 2 B and 4 B, C). After the first
round of plaque purification using Se301 cells and the haemolymph of
cotransfected larvae, we observed several plaques containing polyhedra
that were not infectious for S. exigua larvae (X. Dai, unpublished
data). However, most plaques were pathogenic for S. exigua larvae.
In our study we picked plaques in Se301 cells 3 days p.i. and then
amplified the plaques in Se301 cells for another 3 days before harvesting
the polyhedra-containing cells. Thus, recombinant SeXD1 grown in Se301
cells for about two passages still retained its biological activity and
consisted of a single genotype. Apparently in Se301 cells the deletion in
SeMNPV does not happen as quickly as in SeUCR cells. Hara et al.
(1993
) reported that SeMNPV produced in
Se301 cells was still infectious for larvae. Recently, Choi et al.
(1999
) generated an SeMNPV
polyhedrin recombinant in these cells, but its
infectivity for insects and its genetic make-up was not studied. Hence,
there might be differences in the induction of defective viruses of SeMNPV
between Se301 and SeUCR cells and some cell factors might be involved in
the generation of deletion mutants.
SeXD1 lacked the p10 gene of SeMNPV and
expressed GFP. SeXD1 also lacked 10593 bp of additional sequence
information of SeMNPV, including egt, gp37, chiA,
v-cath and ten other genes located in this region (IJkel et
al., 1999
). Bioassays showed that the
ST50 value of SeXD1 was 25 % lower than that of wt SeMNPV, but
that the LD50 value of SeXD1 was approximately the same as for
wt SeMNPV (Table 1). The result suggests that the
absence of one or more genes may be responsible for the enhanced speed of
kill. Various studies showed that deletion of p10 did not lead to
an increased speed of kill (Martens et al., 1995
; Bianchi et al., 2000
). Recent results also indicated that GFP does
not affect the biological activity of Helicoverpa armigera SNPV
(Chen et al., 2000
). It has been reported
that the ecdysteroid egt is a key enzyme in abrogating the
regulation of host insect metamorphosis (O'Reilly & Miller, 1989
). It conjugates ecdysteroids with sugars and
hence blocks moulting of the insect. Insects infected with an
egt-deleted virus exhibit reduced feeding and earlier mortality
compared to wt virus-infected larvae (O'Reilly & Miller, 1991
; O'Reilly, 1995
; Flipsen et al., 1995
). Another study has shown that the LT50 value
of egt-deleted Lymantria dispar (Ld) MNPV was about 33 %
lower than that of wt LdMNPV for fifth instar L. dispar larvae
(Slavicek et al., 1999
). Our findings are thus consistent with these studies on
egt deletion mutants.
Of those ORFs deleted from SeXD1, ORFs 17, 18 and 21
have homologues in Xestia c-nigrum granulovirus (Hayakawa et
al., 1999
). ORFs 15 and 28 have homologues in
LdMNPV (Kuzio et al., 1999
). ORFs 20, 22, 23 and 24 are unique to SeMNPV (IJkel et
al., 1999
), but their function is unknown.
SeXD1 was able to replicate in S. exigua larvae as well as in the
cultured Se301 and SeUCR cells, so all the deleted genes are dispensable
for virus replication both in vivo and in vitro.
Baculovirus gp37 encodes a spindle-like
protein, clearly related to fusolin of entomopoxviruses (EPVs) (Dall et
al., 1993
; Liu & Carstens, 1996
; Mitsuhashi et al., 1997
). There is accumulating evidence that fusolin
of EPVs can enhance NPV infection in insects (Mitsuhashi et al.,
1998
; Hayakawa et al., 1996
). Baculovirus gp37 might also be
involved in enhancing virus infection in insects (Phanis et al.,
1999
) and the gp37/fusolin
gene family might be essential for virus replication (Wu & Miller,
1989
). In the present study, the absence
of gp37 did not affect virus replication in a detectable way either
in cell culture or in insects. Thus, it remains enigmatic what the
function of gp37 is in the biology of baculovirus
infection.
The baculovirus-infected insect host liquefies after
death (Volkman & Keddie, 1990
) and polyhedra are released. This process plays an
important role in ensuring the efficient dissemination of virus by
physical forces such as wind and rain splash. It has been reported that
chiA and v-cath are involved in the liquefaction process of
virus-infected insect larvae (Ohkawa et al., 1994
; Rawlings et al., 1992
; Slack et al., 1995
; Hawtin et al., 1997
). Recombinant SeXD1 with a chiA and v-cath
deletion could not liquefy S. exigua larvae, consistent with
previous reports. Gopalakrishnan et al. (1995
) reported that a recombinant AcMNPV containing a
Manduca sexta chiA gene required less time to kill
Spodoptera frugiperda fourth instar larvae when injected into the
haemocoel. However, Hawtin et al. (1997
) reported that deletion of chiA or v-cath
from AcMNPV had no significant effect on LD50 or
ST50 of the recombinant. It is not clear whether the absence of
chiA and v-cath has any effect on the LD50 value
of SeXD1.
As a result of fluorescence microscopic studies
using GFP as a marker, we observed that upon cotransfection of insect
larvae SeMNPV recombination took place predominantly in fat body cells. In
contrast, with AcMNPV, the recombination upon cotransfection was found to
take place typically in the haemocytes (data not shown). GFP also proved
to be a helpful marker in the screening of SeMNPV recombinants. This
marker will be useful in analysing the pathological effects of this virus
in target and non-target hosts using, for example, confocal laser scanning
microscopy. The procedure to generate recombinant viruses followed in this
paper is applicable to many baculovirus species, for instance, to generate
recombinants with improved insecticidal characteristics. The method
applied in this paper may also be useful for the investigation of
naturally occurring genotypic variants in virus isolates and their
insecticidal properties. The isolation of SeXD1 confirms a previous
observation by in vivo cloning of SeMNPV (Muñoz et
al., 1998
, 1999
) that genotypes with different biological and insecticidal
properties exist in natural baculovirus isolates.
The authors thank Magda Usmany for assistance with plaque purification, Felix Bianchi for assistance with the statistical analysis of the bioassay data, Jan van Lent for supplying GFP antibody, Xinwen Chen and Martin Erlandson for their useful suggestions. This research was supported in part by the DutchIsraeli Agricultural Research Program (DIARP) 97/29, by the National Natural Science Foundation of China 39730030, and by a Corporate European 'Aid to Education' grant from E.I. DuPont and Nemours & Co.
References |
© 2000 SGM
This article is now available in the October 2000 print issue of JGV (vol. 81, 2545-2554). The complete issue of the journal may be seen in electronic form on JGV Online.